Description :
From Genome Similarity Track
Location :
Scaffold_4:1922247- 1927550
Transcript NameFunction/comments
Phyin_T30-4PITG_03482Putative uncharacterized protein
Phyin_T30-4PITG_03483Splicing factor U2af large subunit%2C putative
Phyin_T30-4PITG_03484Putative uncharacterized protein
Phyin_T30-4PITG_03485Putative uncharacterized protein

Sequence
5303 bases(100 bases per row)
CAAAGCTGTTCACTTCTTGCAGCGCGCGGCTGCAAAGGTGAGTTCCGGCCATGTAAATCGAGTATCTGGTTCATTTTCTAAACTCGTGATCTTCTTTAAC
CCACCAGAGCGATTCAAACGCCCAGACTAGGCTAGGCTTGCTGTACACCACAGGAAATGGTGTCAAGCAAGATATGGAGCGTGGGGTGGCATTTCTGCAA
AGCGCAAGTTCTCTCACTGCTCATGTCGGCCATTTTGTGCTCGTGCTAAATTGGTAATGATTTCGTTTTTAGGCTGCAGATGCTGGTAGCAGCGTTGCCA
TGACGCGACTTGCAAGCTTGCTGCTTCTCCACACACCTCAACAGAATGGAGCACTGACAGCAACGAATGGATCGTCTTCATCTGCTCAATTTCAAGACCG
TGAGGAGGCACACGACGAAGCCCTGCGCTTACTCTTGAGTGCTGGACATGGTGGACATACTGAGGCTTACTACGCACTTGGCAAACTGCTCGAGACCTCG
TCGCTACTTCGGGACCAATCTGCAGCCCTTCGCTTTTACTCGAAAGCTGCCACTGCAACAACGGTGAGCAGCAATTTGGAAAATTGCGCCAACTACTCCA
ACTTGTCCACTAATTGTGCCTTTGTAGCCTCACACGAAAGCCGCAAAGCGTGTAGCCACAATGTACTACTCGGCTATAGGCAGCAAAACGGATAAATGGA
AGGCACATCGATTCTATACCATCGCAGCAAACGCCGGCGACGCAGAAGCCTTGAACGCGCTTGGTACGACTGTGTTTATCCACCGACTTCATCACATCCC
TCATCGACGCGCGATTCTGACTTGTTGCAAATTGAACAGGTCTCATGTACGAAGAAGGCGACGGCTGCGATTTGAATTTCCGAAAAGCTGCCGAATGCTA
CCGCACCGCTGCAGACCTGAATAGCCCGCATGCCCACTTCAACTTGGGCTGTCTTTTTGCAAATGGCAAAGGCGTCGCTCGTAATGTAGATGCTGCACAA
GCGCATTTCCGGAAGGTGCGTTGACTGACATACTTCCAACTTCAATGGATATTTTACAACTCGAATTTTGCAGGCCGTAGAGCTTGGCTACTCATTGGCA
CAGCAGTTTGTAGCTTGACGAAGCACTGTGCCGCTTGGACGAAGTAGTATGTGTGTTTGTTGCTGCTCTAAATGACACGGAAAGTAAAAGAAGCCACACG
CATTTATTATCGAAGTAATATGCAAGAGGTCCCAGTGAAAAGCACGTACATGCAGCACGTACGTACGTCTCTGTAAATGCCGATTTCGCCACGTTGGCCA
TGGTAACAAGGGTTTCCCACGTATTTACCCTTCGCATCGCTTCACATGCAACAAAGGAAGAAAACCTTACTAGGACCACCTTCAACATACACGACTAAGA
AATCTCCCGACGCGCATATTTGCCCTCGTCCATGAATTCGACAGCCACAGTTCTGTTCGAGAAGCCTCGACCATGAAGCTCCGTGGCCGCAGCTTGGGCC
GATTGCACATCGGCAAACTCAACGAAGACCTTACCGACAGCACTGAGGACCCCGTCACGCGGGCGCGGTAGCAACAATGACGGAACGGCTCCGAAGCGCT
CACACTCGCCCTTGATGTCGTCTAAAATGTCAGCATACTCTTCCTCATCCTCAAGCTCCTCTGGTGTCACCATGTTGAGCAGGACAATCACACGGGAAGG
CGTACCGAGCGGCACGCTCGGGATCCCTGCCATACTCATCGCCTGCATCGCAGCAAGAGACGGGTCCAGTCCCATTTCCAAGCCCGTGTTCACTGTACCT
GCAGCGCTAGCGACAGCCTTGGCGTTCTCCTGCGACATCGCTCGACGAACAGTAAGCGTCTTGTCACCAAGTTGCATGTCGTTCAGTCCAATACACGCAG
CATCCGTCACGTTGATGTCCATGTACTCGCAGAATCCATAGCCCTTCGACAGATTAGAGCTAAGCTCCTTGACAAGGTGGAACGATCGCAGCGGACCGAA
CGCTTGCAGCAGCTCCTTCACTTGTTCCTCATTGAGATGATACGGCAGGCCGCCGATGAAGATCTTACCCGGACCATCACTCACAGTGGTGGACACAATG
CCCAGAGCAGCCAAATTAAGCTGAGGGATCGGTCCCAGGTCCTTGGGGACCGTAGCCGGGTTATAATCGTTAGGACGGCGGATCTTTAATGGCTGTCCAT
TATACGACACACCATCCAGATTCATACAAGCCGTCGTGAGCTCAATGGAGCGCAGTTCAACAAAAGCAAAGTGACGCTCGCGGTTGATGTACACGGACAC
CACGGAGCCTCCTTCCTGCTTCTCGCCCAGCGCTCGGTCAATGACATCGTTAAAGAACGCGGTGATCTCTGGCTCGGAGATCTCGCCGATGCCGCCAACG
TACAGTCGACGAGCGTGACGCGTCTGCTGCGACAAACCCGAGGAGAAGCCGTAGCCTGGGTTCGGGTTTGAATGCGTATGCAATGACGCGGGCGGGGCAT
TCTAAATAAGAGGTAAACAACAGGAAAAACATAACGAGTTAGAGGACATGCGAGAGAACCGCGCTCGTCATCCAGCGCCACTCCGGGACACTATAGAGCT
GCCACGACGGACAGACAACGGACAACGCACACACAACGACACCGTGTCAGCCGTTGTATCTCTCCGTGCTGTTGGCAGCCGTGCTTTCGTGAATGATGTT
GGACAAAAATTGACTCACCCCAGTAGGCGTAGACGTCTGCGGCGGACCGAAAGATGATGCGCCGACCGAGCCCGACAGTGCAGCCATATTCTGCTGCAGA
ATGGCTTGGGCAGCGTAGGCTGCCGCGTTCTTCTCTGTGACTCCGGGTGGGCGCACGTCAAAGTTAGATTTCTTGCGGCGACGAACGATGCGCGTCGACG
AGCGCGAACGGCTGCGACTGCGTCTGGCTGAACGACGCTCCGACTGGTCGCGGGAGCGACGGTGCTCGCGCTCCCGACTGCGGCTGCGACGATCACGAGA
CGATCGATGGCGTGAGGAGCGTCTCTCTTTGCTGCGGCTGCGATCACGGCGGTGCGACGAGCGCGAGCGACTGCGACGACTGCGGTGAGAGCTGCGGCGG
AGATCTTCGGCGGGGTTTGCGGACTTGGAGCTGCCATTTGAAGCCTCCTGATGAGAATGCACAACGTTAGTACAATTTCATGAAGGTTAAATGGTGGAAT
GGCTCCTACATACCGGTGCATTGGCGAACTGAGACGGCGCGGACGGGGGCATTCGCGGAGGCTGTAGCTGGTGGTGGGGAGGAGGATACGCACCACGCGG
TGGGGGAAGAGGGTGCGCAGGTCCCGTTTCCTGCTGCTGCTTTTTCATCCACGCGGGCAGCGTGAGCTCTCGTCCGCGGCCGGCCATGTTTCTCGTGCTG
AAGCTTGATCTATCTGCTGCTTCGTCCACCACTGCCCGCCTCCCCGTGGCAGTCACTTTCAAAACCTGTGAGAATGGATAATAAATGAGCTCGGCGAAAC
CTATATGTACAAATTATAATAATCGACAGATGTTTTGCAGTGAAGCTGTTGTTTGTAAAATATAAAGTATTTCATTAAAAGGAAATTGACGACCATCTCT
ATTCAGCTAAAGAGGTCTAGCTGAAGTTGAAGCTCACGTGCCGCAGTCACGCATGACCTGCTGCGCAATAGATAGTGTGTTAGCGTCGCTGCCTGAAGGG
ATTTCGCTATTCCAAGTGCATGGAGGGAGCTGTTCCATCTTCTGGACGGCACGCTTGCACGCTTCTTGGTCGCAAAATTTGCGCGATTGGTCACCTGGAA
GCCACTTGCTGGGAGTGAACAGAAGCGGCGCGACACATTCTCTTAATGCGTCAGCCAGGCCTCCCTCGTTCGTAGTGAGAGTGAAGCGCAGTTGAGAAAA
ACCATCGCAGGATGTTGCATCGCCTGCAGCAGTCTTCGTCGCCAGCAGTACCAGGAGCTCTTGAATTCGCATTTTTAGAAATCAAAATGCGCGTTGGTCA
GTCCCAATCACAGAAGGGTGACATAAATTAGGAAGACGTTGACATGAGAACTCCATGGGTTTCTCGAAGCCAACGACCCTTCATGCAATAGATAAAGATA
TTCCACGAGCTTCAAAAAGACTCAAGAACAATGAGTGCGAATCGAGCGGTCTCCAAGCGAACAGAGGATCTCTTCCGCGCGAGCGAGATCGGGGACTTAC
AGTTAGTCTCAAACCTGCTTCAAGACCCAGAAGTTGACATCAACTGGCAGTGCACGCAGTCGGTGAGGAGCGAACAAAACTTGTTTGCTTGATATGAGCC
GTTGACCGAGACTTCTGTGTTTTCTCGAAGTACGGAGCTACGCCACTCATAGCTGCTATCTCCCATGATCACCAAGATATCGTCGAGATCCTACTAAAAG
CTGACGCGGAGCTGGAAGTTCTTAAGACCCCCGTAAAATACGTGTATCACGGCATGCGTAGGCAAGTGAATGTCAACAACTGATATGTTGCTGGCTGCCT
GCAGGATCGCAATAGTCCACTGCACGAGGCAGCTTTCAGAGGCAATCCGAATATCATGCAACTCGTTTTGAAAAAGATTCTTGAGAAATCGGGCGACGAC
GCTATTGATCTCGTGAACTTGCAAAACCAAGTAAGAACTTCCGTTTGCCATGTTAGAAGATTAAGTGTTGATTTTTTTTATCTATTTTGCTTTTGTGGAG
TTTGGAAATACGCCTTTGCACAACGCAGCTCGAACAGGAAGCCCAGGATGCGTCTCCTTTTTGTTGCAGGCTGGTGCGAAGCATTTCATAAAGAATGCTG
TAAGTGCGCTCTACAAGTGCTCTTTGATAATATAAGTTAGTAGTGTACTGAATGATACTTGGCCGCCTTGCTGCAGAATGGATCCATTCCACTCCACCAC
GCGTGCTATAGTGAACTGCCGAGCCTGGAAGTCGTGCAGCTACTTGTGGAAGCTGGATCTGATGTCAACGCGCTGGACGAGCAGGGATGCTCGCCGCTCA
TTGTAGCTGCTAAGAAGAATCAATCGGAAGCCATCGATTATCTGCGCAAACACGGCGCCGACGCCACGCTCAAGAACTCGGTATGTGTTCGTCACTCTTC
CCTTGCTAATACTGGTAGCCTTACTTGATTTTGCAATCACTTGTATCAGTTCGGTGAAGACGCACTCCACTTTGCGGAGCTGCGCAACAATGCAGGTGTG
ATCCAGTTATTGGAATGATAAAAAAAATCGCACAAACGTGCCGAATCCTAGTCAACCACGTGTCGTACACCTGCCGCACCAGTAGAAACGAATGCTTTTC
GCA