Description :
From Genome Similarity Track
Location :
Scaffold_19:192159- 193163
Transcript NameFunction/comments
Albla_Nc14024000PREDICTEDx3a similar to tripeptidyl peptidase II isoform 2 putative

Sequence
1004 bases(100 bases per row)
GTGACTTTGCTTTTCTCACAAACTTTGGTAAATTCATATGTCAAAAGAAGCTGATACACCTGTCGTTTCTCTTCTTCGGTTTGTTGGTCGCTTTGTTCGG
CTTTTTGGTCAATTGAGCTAGCATTTGGACTGTTGAAGAGCGGAAGAGGAGTAATCGCACTCGACAATGGTCGAAGTCGCTGCTGTAATTGACCTAATGT
CGCTGTTGGCTTAAGTCGTTCTGTCTGGATCGTATTGGAAAGCTGTACCAAAGAGCTTTGTATAGCACCACCGTTCAATTGAATGCTTTTCTGATTTGAT
GAAATGCTGTGAAATTGAACGCGAACGGAGAGCTCTGAGTCTCCAAGCGAGCTCCAGAATTGAGCCACACAGATTTCCAGCGTGTATTTGTCTTCAACTG
CAAAGCTGAACGCTTCTGATTCCTCCAATGAGAGAAGTACATATTTCGTGAATTCCGACTGCGACTGCTTCTTGAAGGGGATCATTTGTAACGTGTGGAG
TACATATCGAATCGAATTTGACGACTTGGAGATGCAAGAAGGTGGACCTTGTCGAGAGAGCACAACGTCGGCCCAGGTAGAGCCGTAAGGCGGTGTGTAG
TGATAACGATGAATAGATCCTGGTTGAAAGTTATTCTTGAATGCCAAAGAACCGTCTCGAGGTACAGCTACAGGCCTGAAGACAGTGATCGGAACTCTGA
ATAGTGGTCCTCGTTCTTTGTTGTTTGTATCGAACGCTTTGATCTCTCCATAATGCTGCTCATGACCCAAATACTCGGTGTTAATAGATATCTGAAAAGT
GCGTCCTTCTTGCATCATCGCCACATGACGTCCGACTTGAATCCATCGTTCTGAAGGAACAAGTTCCAGGTACAATTCGAATGCAACTTTGTCAGATTTG
GCAGTTGACTTGTGAAAAATTGGCTTGATTTGCACGGAAGCTTCCATAGTGGAAAGCTCGAAATCAGCTTGTTGCTGAAGATGAATTCCACGATTCCCAG
CGGT