Description :
From Genome Similarity Track
Location :
Scaffold_206:19215- 24519
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_206-snap-gene-0.18Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_206-snap-gene-0.19Pattern formation protein

Sequence
5304 bases(100 bases per row)
CGCTTCTCGAAACTGAAGGACTAGACGAAGAGGCCAAGGACCGACACAAGCACGAGGATCCTCTCGAGTACGACCTCTTGGAGCTGTATGAAGGGTGTGT
GAAGACGCTCCAGTCAGTGAACTGCATACGAGCAGAGGCTGGtaCCAGTGGTGTCTCCGTGGTATTTGATGGGTGGAATATTTTCAGCATTTTTCCTCGA
GTCGTCCCAATGACTGCGGCTAAGCGAGCACCCcTCGTGCGCACGAGGAGCACTACGTCGAATGGATCGAACTCAAGTGCGGCTAGTGCACCAGCAGCAG
GTTCAAGAGGTGGGATATCGACGGCCTCAACAGCGGGCTAGCACCACGTCGAAAGAACAGTATAACAGACACAATGCAGAGCGAGGATCGATGAGATCAG
ctAGATGTCTCAACAGAACGTCTTCATCAAACCGTTGGTGCTGCCCTCCTGGAAAAAAATGCTAAAAACCGGAGGGTACACTGGATcATCaCTTCTCATG
GATCGCATCGACAATAGAATGAAATGAAGTAGTGCACTGGGATCTGAATGCGCCTTATCAACAGAACATCCGCCACCGGAAGCGGTGTTGGTACTGCCTC
CCTGTTGGTTGAGGCAGAGAGGCCTGAAGAATTCGTCACGTCCCACTACAAATGGTCTGCAAGTCGTTTGATGGTCGGTGTAACTATGACTAGAATGCTA
GGCTCATGGTAGGACAGAGCGAGCCAAAACGGCCGCcATGCGTCCAGTCGCATGCACATGGGATAAAGTTATCGTCACTCCATCGAACTCGACTCGCACA
CTAcGAATGCACACGTATTTCCTTGCAATGGATGGTCAGTGTAACTATGACTAGGTTGTAAATGCTCATGGAGAGACGAACAGGCCAAAaCGACCcGCCC
AATCTGTTCACGAATACAGgAATTTTCCTtATCTtCATCCCATCCAGTTCACTATCAGCTCCTACAGGCCTCGACGCGTTCAATCGCTGAGGAAGAGGCC
ACATGTACGCGCCGCCACAATCGCCTGCGCAACTCGTCGACTGCCTGGTGAGGAGGTGTAGCTCTTCGTTTTCGCATCCTCTCGTGAACCAGTCGTCGAT
GTtcATGTGGTCCACATATtATACTTAATgTCTATGAAGaGTTTAAAACATGTTtAATTCagTTGgCCGTGCGgAACATCCGCGTCCGGGTCGGGTTCAA
aGGGTTAAGCGAAATGagTTCAGGTGAACCCGTTTGGtCCGGTGAACCcGTTTCCCTTGTCAGCACCATCTTCCCCCCACGTGGAGAAGCAGGGCGGCAA
TTGGCGGGGAAAATGGCCGAAGTGGCCGTACGTTCCGTGCTGCTGGGCGAGATCCAGAGCGTTCTGAGCATCGCGCGTCGGCGCTATGGATATGCACTCG
TCCACCAAGGTAGCAAGGCTTCTCAGGTGCGCGGAATCACTATGGAAGCGGCACTGCTCCCTTcTAAAGCTGGCATGTTGAAGGATGACCCTCAAGGGGG
TATTTTCCATAGTTTCGCACTGCTTCGCGCGAGACTGCTACGCTCAGAAGgTGAATATGCATGTGTGTGTATGAAATTGTGTGATGGATTGGTAGCTGAT
GACGCGCGTGTGCCAGATCTTACCGACCTGAATCCAAGTACTGTCCTTCGTCCGTTCCTCGACCTCATCCGTCATGAGCACACCAGCAGCACGCTCACAG
GCGCGGCCCTGGAGGCCGTGCAGCATTTTCTTCAAAGCTGGGCGTGGCACGTGAATCGCACAGGCGTATCGGATATGCTCGGTGACATTGTGGACGCTGT
GAGCCACTGCCGGTTCCAGGAAACCAACGctGAGAGTGATCAGCATGTACTTGTGCTCGTCGTGCTCGTGCTTCAGGCTGTGCTGTCGTGCCCCGCAGCC
AGGCAGCTCTCTGACCATGCGATGTGGCAGCTAGTAGAAGCGCTCTACGCGATCAGTCGTGCCAACCGCAATGATGTACGTACTGTCTTGACGCCTGAAT
GGCGTCCCAcGCATCACGCTGACTCAATCTGTAGGCGCATATTACACTGTCTCTGCGTGCAATAGCGACAAACGTTCTGGATCAGGCCATCGAGTTCATC
TTCCAGAGTCCTGCAATTTACTCCGATGTGTCAAACGCTCAAACGACAGTGAACGAATCCGGCTTTGGACTTCCATGTGCCGTCAAGATTGTCGGTTTCT
TGTGTCAGAAGCTACAGCCGCGTGGGTCTCTCATCGGTTCTTCGAGCGCTTCAGGTGCATTACTACCGACACGCCGGGAAGTGCTGCTCTCGTTCACCCT
CATGCATCGCGTGCTCGTTGCATGTGATGCGGAACTACTCACGAAGATTCCGTCGCTCATGCTTTTCATCAAGGACGATTTATGTGGTTCACTGCTGCGA
TATGGTCGACTTGGTGCCAGCACCGACCTCAAAATCGCTGTTCTTTGTCTAGACACTTTCCGTTTATTGTGGACGAAGCTCCGGTCGATGCTCAAGATGC
AAATGGAAGCTCTCTTCAATGGCATTTTTTGCCATACATTGCACTGGACTGTAGCGCATCTTGACCTTGCTCACCCGATTTTtCCCAACAACCTGGAGTC
ATCGCCTTCAACTTCAGGTGACTCTAATCAACGAGACAGTTCCAGTACTTTCATGAaCGTTGATGCTGTGCGTGAAGagTTCACCGGCGAGATTGTCCCA
TTGAACAAGTTATtCTCCATCTCCTTCGAGATACtcGACTGCCTTGTCGATATGCTTGCCGAGCCAACCTTGTTACCAGATTTGTATGTGAACTACGACT
GCGACGGTAACCGATCCGACCTTACCCACACGTTGTTTGAACTACTATCTCTAGTTGTTGTCAAAACGCACGATGCTTGCCAAGAAACAAGTGACGAAGT
TCATTTCCTGTGGGCACAAGCTGCCGGTGAGCTCGCACTCCGTGGTCTCTTCAATGCTCTCTATGTTGTCTACACAAGATCTATGGAAAAaTCCACcATG
ACCTCCATGGATGGCGTCGAATCCACTGGAGCTGAGTCACTGCATCGTAAACGTCAGCGCAAGAAAGTATTCCAGCACGGAATCCTAGAGTTCAACCGCA
AGCCATTGTCCGGGATCAAGTACTTACAGCAGCATGATTTCCTGCCGACACCATTGGATGCAAAaTCTTTGGCTaCGTTCTTGCGGTCACTTCCCCCGGG
TCTACAGAAGTCTGCAGTTGGtGTATACCTCGGTGCAATGGGGAAAgAAGTGAAAGATTTCGAGAAGTCCGACATACATGAGGCGGACACTATTGAATTC
CATCGCGATGTACTAGAGCACTTTGTGCGCTCATTCAGCTTCGAGAGTGAAAGCATTGTTGCAGCCCTCCGAATGTTCCTtGCTAGCTTTCGTCTACCTG
GGGAGGCTCAACAGATTGATCGCATCCTCAACACTTTTTCCACACAAGTTTTCGAGCAATGTCGGGATAGGTTTTTGATGGCCTCTCCAGATGTTGCGTA
CCTGTTGTCTTTCAGTTTGATCATGTTGAATACAGATCTTCATAATCCCAACATTCGTCCCGAGAAGAAGATGAAGCTTGAAGACTTCATCAAGAACAAT
CGAAACTATGGCGAGGAGGTGTCCAAGAACCAGGATCTTCCAGACGACTTCTTGACGGAGCTCTACGAAGCGATCGCAAAAGaGGAAATCAAAACTCGTG
AGGATGACAGCAAGCACGGTGAGGTGACAACTGACCGCTGGAAGGATCTTTTGTATCAGGCTGAAAGTGATCCTCAAGGATCCCGTCTCATTGTTCATCA
GTCGCTAAGGAGCTTGCTTTCATCGCCTCTGTTAAACGGTGTAAGCTCATCAAATGCTGATGTCGATGATGAGTCAAGTGATGATATTGACGAAAGAAGC
TCAGGTCACCAGTATGACCAAGACATATTTCAATTAATGCGAGAGAAGCTGAAGCGGGCATTCACTAGTGTGTTCCAGCAGTTTGTGGACGTTACGACGG
CAGTTACCAGTAGCACCACcGATGGAACGGAAACGCGCATGACAATTCCAGAGGATGTGTATCTACCTGACAAAGGGATGCTTCAGCTTGCATGCAATGG
ATTTGTTCTGTGTGCTGGAACCGCCGCTTCCCATAGTCTTTCTCGAGAGTTCAACGAATTATTTGCGACTGTGGCGAAGTTTAGCGGTCTGTACTCGTCA
GACGTATTCGGGGTGGCTTACAACGGTCTACCGAATGGTGTCGAACTATTTTGTCACAACCAGAGTGCTCCTGTTGCTACTGCAGCTATGCTGAAGATCG
TTGGCAGCTGTGGTAATGCACTTGACAAGGAGAGTTGGAAACACTTTTTCCATGCCATCAGTGCCTTACGCGAATTTGATGCTCTTCCTCATCGGTTACT
CCATGGCACGTACGGCACAATTGATGCTCTTTTAACTGCCGAAGAAAGTGTGCAGATTGTTGATCTCGTGCAACACAACCGCGAAGAGCTCGAACGAAGG
GAGGCGATGCGCTTGAAGGAATTGGAAAGAAGCAATAGCAGTTCCAGCTTTTtCAGCGGAATGGCTTGGTTAATGTCTGCGCTCGATTCAGCGCCAAGCT
CTCCTGctGTAATTACTCGTCCTATCATCGAGATGGACAGAGGTCAACTGACACCTGCCGAGCTCGCAGTAAATGCTCGTGATCTCGTGATTCATCCTTC
TCCTAAAGCAGACACGCCAACAACAGGGAcGTTTGGGACGAGTGAATGGATCCAACAAACACTGCAACCGTACCGCGTAGACTGTTTGATTGATGATTTA
TCGGCGCTCCCCACAGAGGCGCTTGCAGAAGTTCTGAAGAGTCTTCATGATGAAATTGTTCATGTTCTCTCGGGGACACCTGTCCCTTCAAACCCGAAGC
CTTTGACTCAATCTGAGGGCGCTAAACGACGAACGTCGACATTTCCTCCgtCATCATCAAGACTAGAGGACTCGCTGGCACCGAAAGCGAACTTGGGTAT
TCGTCTTCTCAGTCCTGCGTCATGTGTACTGTTCGAGCACATCATTTCGCGCATACTTGCTaCTTTACCTCGTGAAGGTATCATCGAGCACGTTGGACAC
GTCTGGGAAACGCTCGAGGGGCACTACGTCAAACTCCCTTCGCTCCTTCGACCTATTCTGATCAAGAATGCCGTCATCAATGGTATTGGATATGAGAGTG
CTGCTTTGACTCTGGagAAAGCTCTtGAAGGGTTGCTCTCGTTGACTCTGAAGACTCGGGATGAAAGGGCACTTCTATTACTGTTGAATGTTCTCACAAG
TCTC