Description :
From Genome Similarity Track
Location :
Scaffold_66:19214- 20525
Sequence
1311 bases(100 bases per row)
GCGGTTCACAGCTGAGTTCTGGCTTTCCGTGCTCAGAACACTCGGAAAGCGTTTATGTCTACATCTGAACACCCTGAAACAGATGGTCAGACGGAACGCG
CCAACCGTGTTCTTAAAGAGATCCTTCGAGGGTACGTCTATTCGTTTACGAATTGGAGCGAATTCTTACCAATGGTGGAATTCGACATCAACAACTCGGT
ACTCGCTTCGACGAAGCATACGCCATTCTTCGTGAATGGCTTACGCCATCCTCTTCAACCCACATTATTAGAGTGTGACTCTAGTTAAAGGGAGGGGATT
CCTTCGAGCGAACGCCAATCCGGCTCTCACTCATCACGTGCTGACCATGAGGTCACCGCGTTCGACGCCGATGTCGATCACATCAACTTCGGTTGAGAAG
AGGAAAGTAAGAGCGAGGATGCTCTTACTCACCACGATTCTGATCGAATCAGCATCCCGCCTGGTGCGTCTGAAGACACACTCACAGAGGCAACAAGTGA
TCTTGATGTAGTACACTCCAAGAGTACTGTAGCTAAAGACAGCAAGTCAGCAGATAGATTCATACTAGCTCCCAAAAAGGTTGTTTATTTTGTACAAGAC
TCTATTGCAGAGGTGATAGATCGACAAAAACAAAACGCTGACAAGAGTGGAAGGGCAAACGTTCATTCATTCAATGAATGAGATTTAGTCCTATTATCTA
CGGTAAACCTACCTCGACACATAGTGACTAACGTGGGTAGGAACCAGTTACTACCCAAGTTCATCGGTCCATTTCGAGTGCTGCGCCGCCCAGGCAACGC
ATATACGATTGAACCGCCACGTAAGATGCGCATGCATCCTACGTTCTACGTCAGTCGTCTTAGGCCGTACTAACAGTACGGGGCTTCATCCGGTGAAGAA
AGCCCTTGTGCTCAAGCATCCCCAACAGATACTTGTGCTCGCGATGCTGGCTATCAGCCCACGTCTGAAGCTCGGATATCTCCCCGCGAAGCCGAGAGAC
ATCCTGACGAACTTCACCCGGCTGGTTGCGAAGAGAACGCTTAGACCGCTCATTTTCAAGATGGGCAAAGGCAAACTGTGTTCTTTCCTTCTCCCGATCT
AAGCTCAGACGGTTCACATTGTCCAGCAAATCCAGACGCCTGCCTCTCTCGTGTTCGAGGTCCTCGCACAACTCACACGTTACGCGGTCAAGCTGACTCA
AAGCATCAGGTTGGGTATGATAATCAGTCGGACGATGTATTTCCTTCTCCACCTCATCCAATTGGTTGATAATCGCGGCGGTCAACGCTTCTTCGTGGAA
CGCCTGTTGAA