Description :
From Genome Similarity Track
Location :
Scaffold_66:19213- 20519
Sequence
1306 bases(100 bases per row)
CGCGGTTCACAGCTGAGTTCTGGCTTTCCGTGCTCAGAACACTCGGAAAGCGTTTATGTCTACATCTGAACACCCTGAAACAGATGGTCAGACGGAACGC
GCCAACCGTGTTCTTAAAGAGATCCTTCGAGGGTACGTCTATTCGTTTACGAATTGGAGCGAATTCTTACCAATGGTGGAATTCGACATCAACAACTCGG
TACTCGCTTCGACGAAGCATACGCCATTCTTCGTGAATGGCTTACGCCATCCTCTTCAACCCACATTATTAGAGTGTGACTCTAGTTAAAGGGAGGGGAT
TCCTTCGAGCGAACGCCAATCCGGCTCTCACTCATCACGTGCTGACCATGAGGTCACCGCGTTCGACGCCGATGTCGATCACATCAACTTCGGTTGAGAA
GAGGAAAGTAAGAGCGAGGATGCTCTTACTCACCACGATTCTGATCGAATCAGCATCCCGCCTGGTGCGTCTGAAGACACACTCACAGAGGCAACAAGTG
ATCTTGATGTAGTACACTCCAAGAGTACTGTAGCTAAAGACAGCAAGTCAGCAGATAGATTCATACTAGCTCCCAAAAAGGTTGTTTATTTTGTACAAGA
CTCTATTGCAGAGGTGATAGATCGACAAAAACAAAACGCTGACAAGAGTGGAAGGGCAAACGTTCATTCATTCAATGAATGAGATTTAGTCCTATTATCT
ACGGTAAACCTACCTCGACACATAGTGACTAACGTGGGTAGGAACCAGTTACTACCCAAGTTCATCGGTCCATTTCGAGTGCTGCGCCGCCCAGGCAACG
CATATACGATTGAACCGCCACGTAAGATGCGCATGCATCCTACGTTCTACGTCAGTCGTCTTAGGCCGTACTAACAGTACGGGGCTTCATCCGGTGAAGA
AAGCCCTTGTGCTCAAGCATCCCCAACAGATACTTGTGCTCGCGATGCTGGCTATCAGCCCACGTCTGAAGCTCGGATATCTCCCCGCGAAGCCGAGAGA
CATCCTGACGAACTTCACCCGGCTGGTTGCGAAGAGAACGCTTAGACCGCTCATTTTCAAGATGGGCAAAGGCAAACTGTGTTCTTTCCTTCTCCCGATC
TAAGCTCAGACGGTTCACATTGTCCAGCAAATCCAGACGCCTGCCTCTCTCGTGTTCGAGGTCCTCGCACAACTCACACGTTACGCGGTCAAGCTGACTC
AAAGCATCAGGTTGGGTATGATAATCAGTCGGACGATGTATTTCCTTCTCCACCTCATCCAATTGGTTGATAATCGCGGCGGTCAACGCTTCTTCGTGGA
ACGCCT