Description :
From Genome Similarity Track
Location :
Scaffold_1517:1921- 3343
Transcript NameFunction/comments
Phyta_totarag13171Major Facilitator Superfamily (MFS)

Sequence
1422 bases(100 bases per row)
GAAGCGCGCTCGCTGCGCCCGACGTGGATCGTGTACTCGTCCGTCGGCATCGCCATGCTCGAGGCCTTCCACTACGGATGGTCCAACTCGCAAGTCAACc
tcagcaccttcagcaacACCGAGACCTGCAACGCTCGACCGCTCGAGGAAGGCACGTGCCTCATGTTCCCCGGCCACACCAAGACGACGTGGACACTGCT
CGTGAACGCGTGGATCGTCGGTGGTATGTTCGGCAGTCTGTTGTCGGGCTTCCTGTCGAACAAGTGGGGTCGTCGCACGACGCTGCGCTTCAACGCGATC
GTCATGGTGCTGGGGTCTGTGATCCAAGTGGTGGCGAACAACCCGACGTGGTTCTCGGCGGGTCGATTCGTGACCGGTGTGGCGAACGGCGTGGCCATGG
CCGTGGTGAATACGTTCCTGAACGAGATCTCGACGCCGCACAACCGTCACGCCCTAGGCACGAACACGCACTTGGCTGCGACCTTGGGTATCTTCGGTGT
GGCGACAACGTTCTGGTACTGGAACACAACTTCTGGTTTCCGTTGGATCGCCGGTATGCCGATCGTGCTTGCTGGTGGGTTCGTGGTGatgtcgttcttc
ttcatggtggaGAGTCCGGTGTGGTTAGTTGCGAATGGcaaagatgaagaagctgagcaggagctggcacgTCTGTATGGAAAGGAGAACGTCAATGTCC
TGATGGGGTGGATTCAAGCAAACGACCGCAGATCCAAATTGCCGTCGATGTTAAGTGGTGCTTCTGACAAGGTGCACACCGAAACAAACTGGACTATCCT
GACCAACAAGAAGTTCCGTAAGCCGCTGGTCATCGCGCTAGGACTGACGTGCATCAACCAGTTGGTGGGTATCAACGCCGTTTTCTTctactcgtcgtcg
attcTGAAAGATGCTGGTATTTCGGACTCGCGCGCCGGTCTCATGATCATTGACATCCTGAACGTTGTGCCCGTGCCTATTGCCGCGGCGCTGACGAAGG
TCATGCGCAAGCGCACCATGCTGATCTCTGGTATTTTCCTGATGGTGCTGTGCTGCATCGGCATGACGTTCTCTCTAGTATACGGTGTGGGTTGgctctc
catcgtcttcctcggacTCTTCGTGGTGGGCTACGACTTGAGTATCGGCCCTCTGCTGTGGCCAATCGTCGCTGAACTCTTTGCGGACTCTGCccgtggt
gctgctgttggcatcTGCATCACGATGAAGTGGATCTGCTCTCTCATCGTGGGCATCGGCTTCCCATACGTCGAGGAGGCCATCACGAACTACAGCTTCA
TGCCGTTCCTGGGGACGACCATCCtttccatcatcttcatctacTTCATGGTGCCGGAGACGTCCGACATGACGATTGCTGAGATTCAGGACGGATTCCG
CAGCGACCACAGTgtgcagtcg