Description :
From Genome Similarity Track
Location :
Scaffold_254:19200- 22898
Sequence
3698 bases(100 bases per row)
ACACAGCATCTGCCCAGTGTCGTAAATTCGCCGGAGGACTGGGCTCTTTGCTATCGTGTATGCCATCTCGCTGCTGGCAACAAGGTGTGTCTGGTGTTGT
TGATGTTGTTTATGGACACGGAGTACTGAGTGAGCAAACGTCTTGCGTGATTTAGAGCTGCTGCATCAAGTCACACGCACGTGCGAGATCAAGGTCGTGC
AGGTGGTTAACTCGAGCCCTGCGTACAAGCTGCTCTGCGAAACGCAGATGAAGGCACGCGCGGACGCCGAGAAGAAACTCAGGCGCATCAAAGCCACGCA
CAAACGACGATCCTGCCCTCCAGTCGATGTTCCCACTCCGCATATACGCCATGACACCTGGACACACGCTGTCGCTGGACACGCCGCATGGCGCAAATAC
ATAACATGATGTAGACACAACCTCGTCTGCGCTGTGCGCCCCGCCGTCGTCCGCGCCCTCCTCGACGTCATCGTCCACGTTGCTGCCGCCGAGAGCTGCG
TATACATCTGAATAACCTCTTTATGTATAAGAAAATCCTTTTAAACGGCTAAAAAACATTTCGTAGGTGGGTACCGAAGCTTTGCAGTTGCTCTGGTATA
TCGGTCGAATTTACGGTGAGAGCACTGCTCGCTGTGGGGAAGGCACTACTGCACGTGGTCTAAGAACCGCACGACCACAAAGCTGCTGTCGACGACCACG
CCATACGAAGCGATGAACGCGATCAAGCCAAACGTCAGCCACCTGCGCGCGCGGGGATACGAGACTTTCGCCCTCATCCATGCGGATTCGAGGTAGCGAA
AGGAGAAGCTGAACTCAAGGGCAAGTGCAACTCTGTTCATTGGCTACAGCTCTGATACCAAGGGCTACAAGATGCTTAACTCACTGACCGGCTCTGTGTT
TACACACCGCCGCGAGGACCTGCGCTTTCAGGAGGCAGTGGCAGTGAAGAAGACCTATCTGCAAGGCGAGTACGCCATACTTGAGAAAACCCCGATTGTG
GCAATGACCAGTGACATGGATGACCTCATCCTCAGTGGCCAGCAAATGGAATAACTGTTGACGAGTATATCTGCTCTGTCGCGTGCCGTGCCAGTGGGAG
ACACCTTAGAAGTTCAAGCGCAAGCAGCGCAAGGTAAGGACAACGGCATGCAAGCGCAACCAACAAGGACGTCAGCGACGTGCCGTCCGCTCACAAGCCA
GCTGCGACAAAGAGGAGGAAGTGCATTTCCAGTGCAGTAATGACAACGAAGAAGCGAGCTCGTGCGAGCACGAGTGACAGAGATATCGACTCGAGGCAGC
CAAGCCTGCCACACTTCGACGCAGACGGCCTCGAGATGAGGTCGCGCCGCAACCGCGAGCCCAACTCTCGGTACCGAGACCTCGTCGTGAACATGGTCGT
GCCAGTCCTAGCGAAGGACATCGTGCTGCCGCGCACAATCAAGGAGGCCATGCGATCGCCGTACCGCAAATACTAGAGATCGGCTATGCAGTCGGAGATC
GACTCCATCTTGAAGCACAAGACCTGACTCAATGTCAAGCGATCGTCAGTGAGCAAGAAGGCGCCCATCGTTACAAACACGTGGATCTTTTCGGTGAGGC
AGGACGAGAAGGGACACATCAAGCGCTTTAAGACCCGCCTAGTTATACACAGCAACCGGCAGCAACACGGCGTCAACCACAATGAGACGTTTGCGACCGT
GATTCGGTTCGAGACCATCAGAGCAGCCATCTACTATGCAAAGCAGAGAGGCTGACTCGTGCAGCAGTATGATGTGAAGACCGTTTTCCTGCATGGTGAC
CTGGAGGAAGAAGTCTACATGGAACAATCGATCGAATTTGAGGAGGACAAGGAGCAGTACGTCCGTCGGCTCGTCAACAACCTGCACGGGGTGAAGCAAG
TGCCGTACTTCTGGAACCAAACCCTGCATGCAGCACCTCCAGAAGCTCGGCTTCGAGTGCCGCGACTCTGATTACGGTTTCTACGCCCGCAAAGTGGGAG
GTGTGATTGACATGCTCCTCACTGTCTACGTGGACGACTTCCTGCTACTCGGTCCGCCCACGCAGTGCAAAGAAGCTGCAGCGAAGCTTCACGAAGCGTT
CGAGCTCACCTCCCTTGGCCCAATTAAGTACCTCCTCGGCGTTGAAGTCATCGTCGACCAACGAGACATCATGTCCAATCAACAACAGTATGTAGCGAAG
CTGCTGAAGCAGTTCCACATGTCAGGCTGCTGTGGTAAAGCCAAATCCGGAAAACGTCAATTCGGTTAAGTACGATTTGGTGAAGGGCATCGTATCCGCT
GCCCTAGATACGATTCAGCGTGACCGTGACTACTGCCCAAGATACGATACGTGAAGATTTGGGGTGATGATCAAGAGCGTCCCAGGTTCAAGTTCAAGAG
GCGGAAGATTCGGAGGACAGTGGTATCAAAGAAGAGCGGGTGNNNNNNNNNNGAGCGGGAGTCAGAGGGTCGCCAAGCAAAGGGACATGCGGATCTTGGC
TCAAGGTTTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGTTGTGATATGATGATGTATGAGTCTTTGGGTATGATTCGATGTGTGTGAATTGAGAATGGC
ATTTGAATTGGTACCTGCGTTGATCGTTGATATGGATCTTGTGTATATATGGTACCCTCCTACCAAATATTTGTCTGCTTGCAGACTTATGTTCGACTGG
AGGGCACTAAAATGCAAGTGAAGTCGAATGGGATATTTGGCAACATCATGGTATGTCGGTAAGAGATCTCGGGGGCAAGATCGGTGCTCGTGAGGAGTGA
AGAGTGATAATGACCTTATTTAATTCATCCGGAGTCGGAGATCCCATTTTTTTAATATTTTTTTTACCCAAGGCTGTCCATGTGCATAAATGGCAGCTTG
GCTCTACAAGTAAGACCTCTTGCTTACCGCGTGATGTGGTCTCGAAAGCTTAACTGTGACTGAGGGTTCGTATGGCCTTGTCCACATGCTGCGTCAGTGT
GTGCTTAAATGACGCGCGTTGCAGGTTCGCCCTCTCTCACTCATCGACTGACGACATGACAGCGGACATCTTCACGAAGGCGCTCGGGTGAATCAATTTC
GAGAAGTCTCGTGATGCGCTCAACGTGAGACGCATTGGTGACGTGCAAGCAGAACAAGCAAGTGTGATGAAGTCCCGGGAATTTTCAAGTGTCAGCGGTC
TCCAAGATTGCTCCCTCATCCCCAGATGACGCCCGCTCCCAAGATGGCCGCGATAGCCAGAGAATCAGTCTCGAGTTGCAAGATCAGGGGAGTTCGCC