Description :
From Genome Similarity Track
Location :
Scaffold_332:19200- 21465
Transcript NameFunction/comments
Phyta_totarag7224DNA replication licensing factor MCM5

Sequence
2265 bases(100 bases per row)
CAACTACTTGACGCGGGACACAAACTTGTACTGGCTGAGTTGTCGCAGTGATCCCTTCTGAACCATAGCTCGGATCGCTCGTTGGATAGCGTTTGGGTTG
TAGCCCTGCGCCTCGAGACGGCTGTACAATGCGCTGGTCTCGACGCGCGTGCCAATACGCAGAGTGCGATTGATGCtctgctccacctcctgcgcTTTTT
CGTGAAAACCTCCAAACAATCCCTGAGTGCCGCCGTCCTTGGCCGCGTTCATCGTACTCACACTGAACAACCGAATGGCCTCTTGCACATGCTCGCGCGT
GGCTTCGCTGAGAAGGTGCATCTTCGCCAGCGATTCCGAGATACGCACGAGGGCTTCGAGCTGACGCACTGTGACGGGGATAGTAGTTTCGCCGCCCTGC
GTGCGACGCACGTCGTCACGCACACCAACGTAAAAGTCCTGAAGTGCCTGTGCTGCTCCAACCGACAGTCTTGGAGCGCAACGGGTACGGCAGTACGTGA
TGAATTTCTTCAGAAGCCAAGGCTCGAACTCGCCGCCACTGGAGGCATTTTCACTGGCCGAGGGTTTTCCGGCCGCTGACGCGAGCGCGTTGGTGTGCAT
CCGCACCACATGTGCAGCCATTTGTCTGTCTCTTGCGTCGTCCTGGATATCTCGGACAATAAAAATCATGTCGAATCGACTCAGAATCGTGCTCATGAGA
TCGATATTCTCCGAAGCAGAGCGCATGTCGTCGTAGCGACCGAACACGGGGTTTGCAGCCGCCAGCACACTTGCACGCGAGTTCAAAATGGTGGTGATAC
CAGCCTTAGCGATGGAAATGGTCTGCTGTTCCATTGCCTCGTGGATAGCCACTCGGTCCGATTCACGCATCTTatcgaactcgtcgatgcacacgacgcc
gccatcagccagcaccatcgcACCTCCTTCCAGGTAAAACTCACCTTTGGCGTCGCGGATCACAGACGCCGTGAGACCAGCCGCACTACTACCTTTGCCG
GACGTGTACACTCCCACAGGAGCGATTTTCTCCGTAAACTTCAAAAACTGTGATTTTGCCGTACTGGGATCTCCAAGCAACAACACGTTGATGTCTCCTC
GCAAGATCATGCCATCCGGCAGTCGTTTCCTCGATCCCCCTGCCAACAAACACGCaatcgccttcttcatgttcACAGTGTAGTCTCCATAAATGGACGG
GGCGATACTCGCTGCCAATTTCTCGTACAGTTTCGGGTCGCGAGCCATTTCGTGGAAtttctcctcctctgcaGGCGAAAACGTGGCTTTCGCCCGTCcc
gctccttcttcatcgatcTCGATGCCCACCACACGCAAGTACAGCGTGCGAATGGCCACAGCTCCGACGTTTTTGCCTCCTGCATTGACTACGGACGTGA
TGCCCACCACAGACACTCGCGTGCCTGGGGACGCTCTGTCCACCAAGTGCCGATCGGCAATTAGCGCCAAGTTGCGCGGCATCTCGCCAGtcggcaccac
ctccggGTTCTCCTGCAACTTAAGCGTCTGCTGGTCCACGTACTCTCCTTTGTCGGGCAAGACCATGTACGAGTCTTTGGGGCATAACTCTCCGGGGGTC
ACGCCATTATCCTCCTCTCTGTTGCGGTCACAAATGCGGGGGATACTGACCCCACCCATCCCGGATACGGCAACACGTTTTGTGTGTCCGCAATTGCGAC
ATCTCAAAGTTGCCGACACGCACTTGGTGCGCACTCGAGTGGCGCTGATTACGATACCAGGCACTTTCACCAGTCGGTTCATTTCCTGTGCATGCACGTG
CCGAAGAGGCACTGGGGCTTGATCACTGGTCAGAATTGCCTGGATGTCCGGCAAGTTTCCCTTGGCGCGAAGTGAAGAACCGTTATCATATGACGAATCA
ACTGCGGCAACGGACTCTTGGCCTTGGTTGGCTGACACGAGCAGTTGCGCCAACATTTCCTTAGCCGCATTCTCCAACAGAGGCAGTTGCTCCTTCGGAC
TCTTGAGCAGAAgatcttgcagctcttggtCGAAGGCCGCCACGTGCGACACGTTCACTGTCACGAACCAGTGGTTGCGCCGCGCGTTGGCCAAGAGCTG
CTCCCGGTAGTAGAACAGCGGACCGACGCGGAACCCGCGCAGGAAGGCCAGtagacgacgctgcagaacCGCCGGACTGGCACCTTGGCGGGCGTCGGAC
GTCTGCGCGCTCTCCATGCCCACGGCCGACACGCGACCCGCATCCCAATCCATcgttgctcaagc