Description :
From Genome Similarity Track
Location :
Scaffold_958:1920- 3357
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_958-fgenesh-gene-0.0P-type ATPase (P-ATPase) Superfamily

Sequence
1437 bases(100 bases per row)
ATTCTTCGTGGTAGCGAAAGCCGCAACTCGGAATGGACGATCGGTCTCGTGATCTACACTGGCAATGACACCAAGATTGCAATGAACTCGGCTGGTGTTC
CGCTGAAGCGCAGCTTCGTCGAGAAAACGCTGGACACGATGTTTGTTCTCGTTTTGATCATGCTGTTCAGCATTTCGGTCGCGTGCACGCTCGGCAACAA
CAACTGGGACTTTGACACCGGATCCGATAATGGGTCAACGATTCCGTGGTACATCAACACGACCAGCACCAAGACCGGCAAAGACGAGGACAACAACTAC
ATTTTCCTCAGCTACGTGATCCTGTTCAACAACCTCATCCCGTTGTCCATGTACGTCACCATGGAAGGTGTGCGCTTCGTTCACGCGAGGTACATCGAGA
GCGATCTAGAGATGTATGATGAAGCGTCCGATACTCCGGCTCAAGTGCGTAACAGCAACATCAACGAAGATCTCGGGCAGATCCAGTACATCTTCTCCGA
CAAGACAGGAACGCTGACTCGAAACGAAATGATCTTCGCGAAGTGCACGATTGCTGGCCTCCGGTACAACGATGTGGAGCCGGAAGGCCCTGTGTTAACG
CGCCCAGGAACCCGTTTCAACGACGCTCGATTGATTGCACGCCTGAACTCGCACCATTCAACGAAGAACGAGATCCACAACTTCCTTCTCCTTTTAACGA
TCTGCAACACCGTCATCCCAGAGTACGAATCGAGCGACGGAGGTGAAGGCGTTACTGAAAACCCTGCGGCTGCGTCTCCGACAACACAAACCGTGAAGTA
CAATGCGTCGTCGCCCGATGAACAAGCTCTTGTGTGGGCAGCGAACGATCTGGGCTACATCCTTTCATCTCGCGATGGACCGGTTTGCAACACTGTGATT
CAAGGTAAAGCCATGTCGTTCGAGATTCTGAACGTTCTCGAGTTCAACAGCGACCGGAAGAGGATGTCGGTGCTTTTCCGCCACCCGGATGGATGCGTCT
ACCTCTTTTGCAAGGGAGCTGATGACGTGCTCTTCGAATTACTGTCGAAGACTCAACCTCAAGGAGTCGCTCACGTCACGCGTGGCCACCTGCAAGAGTA
TGCATCGGAGGGTTTGCGAACATTGACTTGTGCTATGCGCAAGCTCACGGAGGAAGAATATGAACAGTGGAGTCGACTGTATCGTGAGGCCGAGATGTCG
ATGGAAGGTCGAACGGAGAAGATCGCTCGCGTCTCAGCGCTTATCGAGGTTGATCTAGTGCTGCTTGGTGCCACTGCGATTGAGGACCGGCTTCAAGACG
GTGTCGAGGAATGCATCAGTTCGTTGAGGAAGGCGGGAATCAACTTCTGGGTGCTGACTGGCGATAAGAAGGAGACGGCTTTGAGCATTGGTATGTCGTC
CCACGTCATCGACGACAATATGGATGTTGTTGTCCTC