Description :
From Genome Similarity Track
Location :
Scaffold_79:192- 1195
Transcript NameFunction/comments
g8540.t1OWZ11528.1 Dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl mannosyltransferase [Phytophthora megakarya
g8541.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
CCTCTTCTTTATGGTGCTCTTCCTGGACAAGCACTTCAACATCATTGGAACGTTCCGCGCCGTCCTCATGAAGCCGTTTGCGATTTATGAGCCGTTCCCG
ATCCAGAGTGAGATCGTTGTGACGTCGCTGTTTGTGATCAATTTTGCCGGAATTGTGTTCTCGCGTACGCTGCACTACCAGTTTTACTCGTGGTACTACC
CGACGCTGCCATACTTGCTCTGGTGCTCAGACCTGCCTCTGCTGTTGAAGATGGCGGCGCTGCTGAACAACGAGTACGCCTTCAACACGTTCCCGTCGAC
CACGATGAGCTCGCTCATGCTGCAGCTAACGAACCTTTTCCTGCTCATGACGCTGTACCTGAACCAAAAGTCGAATTCGTTCGTGCCGTACCTGGACGCC
GAGGCCCGCACGAACCTCATCGCTTTCGTGAACGAGGAGTGTTTCGACGGTGCGCGTCAGCTCGCGCTGTACTACGGCAGTGTGACGGAGGAGCTGGCCA
ATGGTGCAACGGTGTCGTCCATCGACGAGCACGAAGTTGTGCTGTCGCTGCCCAAGCTGAAGCTGACGCTCGCCGTTGGTTTCGGCAGCAGCGGCCCCGT
GACTGGCGAGGGCTACGGTCGCCAGGTGCTCAAGGGAATGCTGAGTGAAGCGTCAGAGGGCATCAAGGCTGGCGATACCATGGGCAAACTCATTAACCGC
GAGTTCATGAAGGACAAGGAGCTCAAGAATCTCGTCGGCTCGCTAGACGACCAGGGTAGCAGTACCTCGCTACGTCAGCGTACGACCACCAAGACGACGA
ATGTCTAGGGGAACTAAATACCCTTGTGAATTCGCTTTCCATGTGGTGTACATAAAAGCTCGTGCAAATTTATTCTACCTTGAGCCAGCCATTCTGCTGG
TCGTGTCATGACGGTGGCGTTGGCGTTCGAGAGCGACGATGGCTCGCGGGCCATCGAGATGCAGGTGCAGGTGCAAGAAACTGACGGAGTACGCACAGAA
GAT