Description :
From Genome Similarity Track
Location :
Scaffold_20:191948- 199484
Transcript NameFunction/comments
Physo_258989chitin synthase 4
Physo_536661PREDICTED: uncharacterized protein LOC100824438

Sequence
7536 bases(100 bases per row)
CGAAGAACTCGCCATGCTGCCCGAGCTGAAGGACCTCAGCCCGGAGTGTGACATCTCCAAGGCTGACGTTGGTGAACCCGGCCGGACTTCTCCGGGCGAA
GTGGGCAAGCTGCGAAATATCCTGGAGTATCTTTGCAAGATTTCCTGGGAGATGGAAATGCTGCCCCCGCCCTGGCCAGGGGCATGGTATGTGATCTGGA
CGTAGGTGACGCCAAACCTGTCGCCCAACGTCCGAGGTCTATAGCTCCATATCTCTGGAAGAAGGTCTACGATCTGCTCAAGAAGTTGTTGGAAACCGGT
TTGATTATGTAATCGCAGCCCGCCTCGGCTTCCCCATCATGATCGTCTTGAAGAAGAACGGCGTGGACATTCGCATGTGTATTGACTACCGCGTGGTGAA
TGGGTTCATCCAGCTCTCGACGTACCCACTCCCGCTGATCGACGACTTGTTGGTCGGTTTCGAGGCCGCCATGTGGTTCATGAGCCTCGACATGACCAGC
GGATTCTGGGCGGTGCGCATGACAGAGCGCGCGAAGCTGATCTCAGCTTTCATTTGTCCGCTCGGACATTTCCAGTGGGTGAGAACGCCATCCGGCCTGA
AGAACGCCCCGCTTGTCTACCAGGCCGTGTGGCTTCGTCCGACTCCCACCGGAGGAAGAGAAGCTTGTTGACTCGGATGTGTTGGAATTTCTCGGCCTGG
ATCCCTCGGAGGAAAATGAGTCTGCCCAACAAGAGTCCAGCCGGAAGGTCCCCGCCCTGACTGACGCTATGACAGTGTTCCAGCGGAATATTCCGATGCC
ATCACATATCGGCTCAGTTCTCGACCGGAGTTCTTACATCGATGACACCCTCACCCGGACCTGCTCGATGAGTTGGTCGAAGTCCAGGAGATGGAAGACC
GACGTAGACACGAGCGGATGCCCCTGGCGACCCGTGTCTCGGCCGTGAAGCGCTGGGGCCTGCTCGCCCGGAGGCGTCCACCCGGACGTGGAGCCGAAGT
TCTGGCCGGATGTGGTGGAGATGCCGGCCGCGTCGCCGATCGCTTCCATGTCGGCGTTGTCGCCCTTCTCCTCCTCTTTCGCCTTCGTCTGCGTCGCCAT
CGTGGTCCGCGTTGTTGTCGTCGCGCTCGTCGCCGGTGTCCATTGCCTCGTCACCACTTGCGGTCGCAGATTGGATTTTCATCTGGGTGTAGTGTGACCG
TCCGAGGGTCCGAAAGAATAAGTGACGGATATTTGTATTTGGGTATAACTCTGCATTTGTGGTTATCGCCCAGAATCGTAGGGGCTACGTTGGGAAGTAC
GTATCGCACCCCGCTCGGAGACCCAACGGTGTACAACAACTCACCAACTCGGCCGAGCTCCTTGGTTTGAAGACAAACGACCCGAGAGGGATTGTCACAA
GGAACACACGCCATCTCGGGCGGACAACTTCTGGCGTATCCGCCTGAGAAGTTCTAAGATACTTTGTTCTCACGGAACATTCGCACACTATACACCTGGG
CGGAAAAGGCGTTCACCCGCCTCGCCTCAGTCGGTAGTCGTCTTGCGCACTCCGGTATCGACATTTGAGCTGATGGTTAACAAGAAATCGAGGCGGAAGT
ACATGTATCTCGGCTCATTTCCCCCTAAAAATGGTCGCATGGTCATGCCTCTGGGAGAAAAAAACGAGCTGATAATTTGCTGATTGGATAAAAAGGGTTG
CACTACGACATCATTGGTCAATAATGACTCGTCTCTTGTTGTTTATCTAAATTTAGAGAGTTGGGGATTGGAGGAAGCGCTGGGCAAACAACAGAAGGTG
ACGGGCACGGACGCACGAGTCGCCGCGGGCAATGCGGTGTGGTCCTATCACTCTGTCTACGACCCATAGCAACGGCAGCACTGACATGGCCGACGGCCAG
TAGCATCGCCATGAACTCGTGCGCGCCCATCAGCACGACATGGACTAGAACGCGCAAGCGCCGCATTAGCCGGAGACCGCAGTGCGACCAACAGTCATCC
ATGGAGAGAACACCCTGGCTGACCCTAAGGACGAGGCTAAGCTCCGTGACAGTTCTCGGGTTTCTACGCGCTGTGTTAACACTATTACTCCAACTCCAAC
TCCAACTACAATCGATACGTGTTCTGATACGGTGTACCTCGACATCCTCAGGTTGCTAACGTTAGTAGGCCAGAAGTGCAGGCTGCCACGAGTTTAAGGA
GGATCTGTACAGTCAAATAATCCCTGGTCAACACGATCTGTTTGCGGTCATTACATAGTTGAAGCCCTCTATACAAATTATACCTGCAATAAAGCATGTA
ATACAATTTTGAAGAAGATACATACTCGAAATAACTGTCTCAAAACCCATGACCATTTCGATCACACGGGGGCGAGGAACCATTTTCAAGCAGATACTGT
GATCGCTGTAGGCATCGTTGTAGTCAGCGCAACGTCTACATCACATTGCAAGACAACAAACTTACTTGTGAGCTTTTAAGCTGCTTAAATATTCGCCTTC
GCGCGTTTCGTAGTTTTAGACTTACTTCGAGAATCGTGATTTTCGTTGACCTTAAGCCACGTATCGCTTGTTAATTGGCGCCGAAATTGTTTTTACGAAG
CTGCGGCAGTCAGGGTAGGTACCATCGGTCGAATAGTAGAGAAAATCGTATCTATGGCCATAAACTTCGTTCAAAAACTGAGGAGCGTTTTCATCAATGT
ACTCGCTAATTAGCGGCGACGAACCTAAAGCATTTCGATCGTTGTTGCTGCCTGGCATCCCAACAAACGCATGCTAAACGGCGATCGTGGGGTTCACCGC
GGTCGCGAAGCCAACGAGGGTGACGGACGAGTACGAGCCTCGCGTGAGCGGCGGCATGGAGGGACCGCAGGCGCCGGAGGGGCTGATCAGAGCGGTGGAG
CGCTCGCTGAAAGTGTTCAAGGCCGAGGGCGGCCCCGACGGCCCGACCCAATGCCAGAGTTGCTGCAAGTGGCGACAGCTAGCCACATCGTCGAACGTGC
GCGGCGTCGAGTGCGAAACCGAACTGGGCGATACGTGGTGGAGCATGAGTGCAGTATGGCATGTGGCCAGGTGGACCATCAGGCAGGAGGTGGCTGTCAG
CAGACGATTTCGAGGTGCTGCTGGACGCCGGCAAGATCGCGGACGATCTTGGTGCCGGGATGGCGTGTAGTAGTGTGTCTTGTTACTGTGCGGCGGGGCA
TGACTCAGAGCTGGTGAGCAGCGGCTGCGTCGTGATCGACTTGACGTAGTCGTTCGAGTGGCCCACCAAGGACAAGTCGGTGGCGAAGATGTACGGCGGG
CAGCAGACGGTGGCTGAGGCAAGTCAGTCGACTACTGCCACCGCCACGAGGACCCAGTTAAAGAGAGGAGTGCAGAAGATCGCAGGAGGGCGACACGTCG
AGCAGGGACAAGCAGTGAGTGTGCGTGAAGGCGAGGCGACGTGAGATCTACGACGAGCGGCCAGGAGGCCACGAGAGAGGTGATGAGACGTGAAGAGGGA
GAGGTCCTGGTAGGCTAGGAAGGCGCCCAATGTGTAGGAGAGGTAGAAGTAAGCGGGGACAACGAGCTGCGGTCAGGCAGCTCGACCCTCAGTTGAGATT
TGTTACAGAACTGTAGCAGGTTGAGACTAAATACCTTGCGTTGCGACTGAAGACACAGGCTGCTACGTTAGTGCTGAGCGAGGGCGACGACTAGCTACAA
GCAGTAAGGGGAGGTAAGCGAAGGTAGGCAGGCACTAAGATAAGGGGGCAGTGGCGAGTAGGGCGGCGGGACCGTGGAGAGAGACCACGGGGGTCGAGGT
GCACGAGTAGCGCCTGGACCGAGGGGCGCAAGGGTCCGCGTGTGCCCTCGGGCGAAGGACACCTGCGTCCGTTGCATATTAACCGGGTTTTGCTGGAAGC
AGCCGGCGGGGCTACCCGACCGTCGGTGCCGACAACGCTTCCTCCCAGCCATCCCTATCCCCGTCTGGGCCATAAGCTGTTTGGTCACCACTGTGCGGCC
CCGTGCCGGTAGTCGCCGGAGCTAAGGCTTTCCGCCTAGGTGTCGGTGAGTAGGTCGTCAATGTAACGTAATTCGTCAAGCGAGGTGACGACCCGTAATG
GGATTGGAGGCGTAGTGGCGAGTTACCTACATGGTGGTCATAACAGGTGCCTTCCGGGCTAGGACACGAGTGGAGTGTCTTAGCGGGCTTGGCATTAGCG
GGCGACCCGCAGCGGAAACGATAAGCGTGAGAAGAAGAAGAGAGAGAGAGTGAGCTAACAAAGGGGATTGTATTATTTGAAACAGAAAGAGCTAAGAACG
ACCATGACGACTCAACGTGACGTGCGAGCGGAGCGGCGCGCGAAGAAGCAATAGCAACTGACGGCGTCCACGACGCTGGAGACGGAGGCCGGCCATACTT
TCCAGTACAATCCGTGGGCCACGTAAAATATCCACCACACTCTCCGAGTTTATCCACTTTACTGAGAAAGGGTCTTGCTCATACAAAATCGTCTACGAAA
TCGCTCCTCTGTAAATGTTGCCCGCGTCGATAAGTACTGCTTGTAGACCGATTGTAGGCAAGGACGTAATCGCGATTAAAGTTGGCGCATATCCCAGGCC
TCGAGCCGCCGTGTTTCTTCTTTCGCGATCGCCGCTTGCGCAGAAAGCGACCACGGAGCAAAGGACCTTCGCGCTGATCGAGCTCATTGTCAATGCGATG
GTTTAAATCGGGTTATGTTCTGCCTCAAATTGGCACTATCAATACACCATTCAATACACCATTGGGGATCTAGCAACTATTGCAAGATTAGATATCGCGT
CGTTGTAGCTACCAGCTTGCAATTTGACTTTCACTTTGCCTTATCACTTTTGCAATTTGCACTATTGTTTGAGATGCTCTTAGCCGAAAGCTAATCGAGC
TAAAGTGTTTTGGCACTTAGATGAGCGATTTTCACTAACTAGTTAGCAAATTATTGATATCCGGGGTACAGACAACGACTTACAAAGCCGACATGCTTAA
TGCCAATCTCCTATATAAAACAACGATAAATTCCCTCCTGGCAAATCTGTAAAACTGTCATAAAACACACAGTGTGTTGCATAAATTACACAAGAAAGTA
TATAAAGTACACACACCCAGACGGTATACAAAGATGAAGTCATTTGATTGAATCTGATTGGCTGGTTTACTCATGTTAAGCCTTGCTTGACTTCGTCTGC
CTACTTTTTGCCTCTACCGGCTTTGTAAGTCGTTGTCTGCACGTCCGAAATTGTCAACTTCAAACGCGATTATCTCGGAAACACTTTGTTTGATGCGGTC
TCCTGTTTCACTTAGAGCATCTCCAGCGGCAAGACTAACGGCGGTTCTATCTATAAAGTAACGTGTTAAGACTTGGATTCGAGTCTTAACAGTTCATCCA
GATAAGAAGGAAGCAAAAAGACCCAAAATGGTGAAAGCTGAACAAAAAAACGCTTTACCGGAACAGCTCTAGTTTTAACTTTTTGAAGGGTCCGTTTTTA
GGTCGCGATGACGTCGACAGCAGCGAGAGCAGATCGATGGGAAGCTCGTGATCGCCACAGTCAGGTCCCAGTCAAGAACGGTTGTAACAGGGTTGCACGC
ACAAATGGCTACAGTCACTTGTAACTCTAACAGACACGACGTCCGTTAGAGGTTCGAAAGACTTTCTCGACCTTGGTGTAGACACACCAAAGCTACATAC
ATTTACGATCACCACGACGGCTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAAAGCAGCATCTTTTAGTCAATGAGCGACATGCATAGCATTGGAAT
TCAGCCAACGAGCCGTTGGCAGATTCCCAGTTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAACAAAAATGGCAGTTCTCATTTTAACCCAAAA
ACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGTCCGAGTATAATCAACTCTAGTTTAAACTAAGCTACGCTTCCTCACACACGTGCGCA
CACATGTGAGCTAAAGTGGCGAGCCAAAGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACTGACTACCTGAGTTCGTACGTCACCAC
ACGAACGCGGAGCTGAGAACCTTCCCATGGGTACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGCAACTCACGTTGCACCCGCTGACTGTCCCCACCT
GTCGGATCCAGAGTGGGAGGCCCTCCAACGACTGCCAAAAGTCATTGGTGAGGCGGCTGTAGCTACGATGCTGCGTACGCTAATGTGGAGTAGCGCCCTC
GCAGAGATCTCGCGAATGCGATCTCGCACAAACTCGGCGCGTCTGGATAGCGGTCGCGCCGAGCAAATTATTCCCGGTTGTTGGAGTAGCGTATCTTCGA
AATACAGGCCCAGGTCTTCGCAGGCTTCGGAGTTGGGGGTTCTTGTGTTGACGCTTGTTCCTTGTCGTAGGGCGTCGAGCCTTGGGCGTGCGGCGTTATC
GGGCCGGCGTTTCCTGGGGCTTGTGTGGCGTTATCGGGCCTACAGGGGGATCTTGTGCACGGCGGTTATCAGGCCAGTGCGGTCCTTCGCCTAGGCAGCG
CGTTATCGGGTGCCCACCTAAACGGTATACGTTTAACGTGCCTTTGTTCCAGCACGGGTCTGTGGGGGGTGAGCACCCGAACCAGCAAACGACGGGGGGC
CGCGATATCGAGGCGGCTCTACTTGCCGGTGCTTGGTGGTTCCCCTGGAACCTCGGAGAAGACAGGAGGTCTTTGTGGTTCAGAGAAATTTCGGGACTGA
GTCCTTACCCTGTCCTATGCCCTAGCTACTGGCTACTCCGTACTACTGCTTGCTGAGCCTATCGTTCTGTACCTATCCCTACTTCCGTCGTGCTTGCACT
GCCGTCCTTCAACCTGATTTGCGTGGCGTAATCAAGATCTTACCTCGACGCGTTTTGGTCGGCGCGTTTTGCTCGGCGCGTCTTGCTCGGCGGGTTTTGC
TCGGCGGGAATTAGGGTCGACGCGTTTTGCAGAGACGGGGCACTGGTCGACTCGTCGGATGATTACGCGTCGAGTTGGACTCGGTCGCTGTGTCTCGCGG
CCCATCACCCGCGTCGACTTTCCGTCGAACTCTGCCGCGCGTCGCCCCCATCAATCGCGTCGCGTTTCATCAACTGCGTCGAGTTCATCATCCGCATCCA
TCAGCATTCGTCTCGGCGCCTTCTTTCACCGACGCCGACGTGTCCGCTTCCTCGCTGGGCACTACACCACATCCGTCCCGCTGCCACGCACGCGCACTCC
CCAGATGGGTGTGTCGTTGCGGAACCTGCCCCGCGTGTTGGCCGCATCTCGATTCGTCGAATTCTTCGTCGTCTCCGTCCGCTTCGTTGCCATTCAAGCA
TCATGGTTCGCGCTGAGGACTTCTGCGTCGAGGAGAGCGGGCCCGACACGGGCAACCTCGAGGCTGCGCTGACATCGTCGTCTATGCAAGCAGAGCACAT
CGGTCTCGCCTCCCTGATCCGTCCGATCAGCTCGCG