Description :
From Genome Similarity Track
Location :
Scaffold_30:191944- 198756
Sequence
6812 bases(100 bases per row)
CCCCCCCCCCCCCCCAGATTTTGAGTTTAGTCGAGGGTCCGGCGTGTTGCAATCAAGCCGAATACCAATACCGGCTTTGTACAATTAAAGACCTTCGATC
ATACCAGTAAGGTCTTTCGGGTATACATTGCTGGATGCAGAGACATCGGCTAGCCTGGGCTAGATAAGATGGCGAGGAAGGCGTAGTTTCCCGAGGTAGT
GTGTATAAAGATAGAATCCACGGGAGTTGGTGAGCGCACCCAACCGGTGCTCACTTTCGATCTCTCCTCCCGCAGCGAAAACCCCCAAGGTCTTCTCCCA
TCTCGGACATTCCAACGGCAGCGGTATGTCGCAAACTATTTCTACCTTCGTCCTGGCGTCTTCGGTGTCGTTGGTTTTGCCTACGGCAAAGCGGAAGGCA
CTGTCGCTCGAGGTGGCAAGGTGAAGGTGAAACTGGTCTCAAGCGGACACTGGTTTGAGGAGCAGGGGCCGACTGTCGAGTTGACTAGTGATGAGGTCAC
ACCGATAACTGTCACCGTTGAAGAAGCACTCATTAGTGCTGGAACTTTCGTGGGGGCGTTATTTGCACCTCTCGGGTCAGGCCGGGAGGTGCTCGGGTCT
GGGACTATGGTCTGGTCACTGGGTACAAGTGGTGCACCCAAGAAATGCGAGGTCTACTGGATATGAATTTCGGAGGGCTGAGTCAACCATTGTGTACACG
CCAGACTCGACTCAGGACGTCACCGTCGAAATCTACGCCTTGCAGCCTTGTGCGGGGCTGAGCACAAGCCTCGTCATGACCTCCGAAACGAAGAAGCAAC
ACGAGACAATTTACAACAAGTTCAATGGAATCGACTGCCCTGCCACTCGTGACTCAAAACTGCTGTTGGCTGACGTAGCAAGAAAGCCCATTGATGAAGC
TCGATTGCTCCTGCTACTTGATATCACTAGCTTCGAGGTGTCCCAGGTGGCGGTCCGACATATTCTAGACTACGTATTCTTTAAAGAAGGCGAGCGTACT
CACCCCGCCGGAGCGGAATTTGGTGATACCATCTTCGACGAGGTTGAATCTCAAAGAATTCTCCCAACGACGACAGCCACAAGCCAATCCGAAAACCCCT
CGGGGACAGAGATTGTTCTAAGTGACGGTCTCAGTGACTCGGACGAGGACGAGCACGTCGTCGGTGCTTCAAGACGCGCTGTAAGTCAAGAGGGGCCACC
CGGGTCGAAACTAAGGCGCCGAATAACAACCACGGACGGCAGAGCTAACCCGGTCTCTTTGTCTCAGGCTCCTGTGGTGCCGCGTCGGGACTACGTCTGG
ACCCGGATGTCGACCCACTAATTTCGCTCCATCGCTCTAGAGCAGTGACAGATGCCTCAGCTCAGGGAGTGTTTAATCGCGCCGAAGGAGCGGCCGGCAA
GGCGCATTTTCATCCCACAGGTATGCAGACAACAGTCCACTTAGCGCTCGTGAACGGTAAGTACGCGTCATTTTCGGCGCAGCAGTTTGTGGAATTTGGC
CAGGTGCACTGGTGAAAATTTGGCTTCTTCCCCCACCCTGCTGTCCTGCGTGGTCTGTTTGGTTGGGATTTCGGTACGAGAGGGCTGTCGATACTGCACT
TTGTTCGTGTTACGGAGTTGGAGAAGCGAGAATTGGTGAAAAAGAGCGACATGAGCAATTTCTTCAAGAAGAACGCCCTTCCGCCACCGACAGGTGCAGG
CAATTTAACCATGATAGTTGGCGCGCTAGACGTTCTTGCGCACGTTGCTAGGCAGCTGTATAAGCCAGTGGTGTACGAAGCACTGGGAGGAGTATCGACG
TTCCTGACCGAATTACGTGTAAGCTAGTTACCAACAACACCGGCAGCCCTGGCAGAAATCACAGCTGGGATCGATGACCGATTAGAGCTCTTTCGAGTCT
TCATCGCGGATGAGAGCTGGGCACAAGTGTCTGTTATCAAGTCGCACTTCACCGCTTCACACGAGTCATTTGTCAGGGTTCACCAACTGATACTCTGGCA
GGATGTTGCCTCCGCACTGAAGTCGGCTAAACCCAGCACAAATCGTAGCGAACGAGGGCAACGAAGCTCCGGACAAGACAAGCGAGTCTACATACCTCTC
GAAATTCGCAAAGCGCTACCAAAGCAGGGCAACAAGCAGCTTTGCCTTCCTCTCCACCCAAGGCTGCCGAGGCAAGAATGGAAACTGCATCATCAGCAAC
TTATGTCATTTCATGCCCGCAACTTTGCCCGACAGCGTTCGCGAGTTCGTTGCCAACAATTATGGCGGACATGCACTGATGGTGCCGGGAGGAGACTCAA
GACTCGGTCCCCCCGACGGCGAAGGACCACGCTTTCCACTCCCCACCACTGAAAATTAATATACTGCAAGGCGATCAAGCACCATTCATATCGTCCGCCA
CTCCACACCAGTGGCGTCCAGTATTTCCATTGCCTAACGAAGTCACCAAGCCTTGCACTGGTACAAACTCTGGGACCGGGATTGCAACCGGGCAGCTTGA
CGGATTGACACCGTCGTATCCGGCTGCGGTTGGGCCACTCCAAAGGTTCAATCCTTCGATCCAGTCCACCATCGGACCGCTCAAAAGGTCCCTGCCTTTG
AGCCCGTCCACCCTCGGACCGCTCGAGGAGTTCATATTTCCGAGCCCGTCCATCGTCGGGCCGCTCGCGGAGTTGAAACCCCCGAGCCCGTCCACACTGG
AACTGCCCAACAGGTCCATACCTTTGAGTATGTCCATCCCTAGGTCATTGAGCCAACCCGAAGGCGTGAGGGAACCCGTAATTCAGCACCGCTACGAAGC
TCCGCCATCCGGCCATACATCTCACAACGAATTCGTGTCCAGCAAGCAAAAGCGTCTCGAAAATACCAAATTGATTCGCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTCAATTATTTTGTCGGACTAACCCAGACAAGTTGGCATTCTCAAATAACATGGGATTGTTGTGGACAC
GCACAATGGCTTGTGATAGCTGACAGGTCTTCGTTAACGTGAAGAACTTGTTCGTGGAAGCTGCGGGACTGTTAGACCCAGTTGTGGACGAACTATCGCA
GCACGTTGATGCAATGAGCTCACCACTCTCCACAAAACAGCGCTGGCCTCTCTTGCGTGGACGCGTCGTCAATAGCTTATCAACGAGACAATGGACTGCT
AAAAGCCGTTCCCTTGGTAAGTTGTGAGCGCCAACCTTGCTCATGGAACTGAAATAATGGAGTAACTGCAAAGCCCACGACCTTCTTTAGTGAGCAAGGA
TTTTTTCGAGCATGTCGAATGCGCGCTTCTTCGTCGGCATTTTACAACAGAGCACCAAAGGCCCACTCGAAGTCACATCGAGGGTTGGACACGATCGTGA
AGTGTTTGTGCAAGTTCAGAAAACTGGGGGCGAGTTTGACCCGTGGAGAAGGAAAGTGCCTGATTATATGGCTGAAATCTTGCGCCTAGGGCCTCTGTTC
TTGCTTCAAGTAGGTGAAAACATGAGCAATCAAAATGCACGCAATCAAGGAAACACGACTGAAAAGAAAAGAACACTAGATGAAACGGAGGTGATTATAA
TCGACTAGCCGCTGGTGCAGTGTTCTAGGTTCGAGTTTCTTTGGCTAACAGGATTGACAGCAATCCATTTTCTACAATTAATTAATAGTAGTGCTGCTTC
TGCTGCCTTCACCAAGGATATTATCAGCGTCAATGGTGTTCTCATGGATCACCTTATTGAACGATGTTGCTACCACCAAATGGAGGCGTATTTCTGACGA
CGGGTGTCATGACACTCAAATCATGAAAGTCAACAGCTCTAGTTAAACCAAAATGAGGCATGTGTGGGCTCGTTAGAAAGCTCTAGGCTACCAGTACAAC
GATCGTTTGACTGGATTTGGCGGATTTAAAATCACCCCTCCCATTTACCCAGGCCTGATTACGATGTCTCGGTGGTACAGACAACGACGGTGAAACTCGA
CCCCCCACAAAAACTCGACCCCCCTACAGTCTAAGGTTAAACTCAAGTATAAAAGAAAAGTGACATTTTATTAATTTTAGCCAATAAGCGCGATCTTTAA
CTTTGCTGGACAGCACGCCATGCTGATGCCAAACCAAACTTTCCTGCCATTGTTGCATTCACTAAACGATGGAAGCCCCTCGTCGGCAGAATCACTACAC
CGTCAAGCAGAGGCGGGAAGCGCTGGACCGGATTGCAGTGGAGGGGTGTAAGCCCACCGCCCGAGCGCTCAATATTCCATTGGGTACNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTGCAACACACACTAAGTCAAACCTCGCTGGTCCTCAGAAGGAAGGGTCCAGGACTTTTCA
GCCGGTAAGCGAGGGGGCCGGAGCAAGGCTCCGGCAGGTAGATAGATAGGAGGCTTCTGTAGCACTCCCAAGTCGAACGAGCTCTCTCGTTCTCTGCAAC
ACGCAGCAAATCAATCACACAATCTCTACTTCTTGGACTTGCCGGGCGGGTGAACACTTGAGTTATCAGCTCACGAGTTCACCGGCAGGCATAATCTTGG
CGATCAAGCGGGACCAGACTTACCGTAGCCGGACTTGACTCTTGTGCGATCGGGAGGAAAATCTGCTCTGTTTGTTGCGCCCTGCGGGCGCTTATCGCTA
TACTATGGTTTCCTATATCTCAATACAAATATCTAGTGTGAACTCGTTCGTTGGGAAACTCCTGGATTCCTGACGACTGCTCAGCGAGGTCTCAGGAGGC
GTATCCGGCATATCTTCCGGATGTGACTTCTCTTCAAAGGGCACGACTCGGATATCTTCCCTGACATGACTCCTCGTCAGGCCGTAGTGTGTCGTACATC
ACCTCGCTCTTGTGCCTTGTCATTCTGCCGCGGGTCTTCTACGCCAATCAACGCCCTGTCGCACACTTCCCCCAACGGGATTCTGATGACCAGACCTCGA
AACCAACGGCGGCAACGGCGACGGCAGCTCCGGTCAATTCACTACACCACATTAGTGATATATTTGGCCCAAATGTGCGAACCCTGCGGCGTTGGTACAA
CGTTTTTTTTAACTAACGGTGTAGAGGATTGAATATTCGCTGCTAGAACTGCGTGTGGATTACCTTTTCGAGCAGAGTAGCGGAGAGACCCTCCGAGCAA
AGCTGGCAGCTTTAATTTTGTTAGTTCTTTATATTCCATCACTTTTCATTTGGAAGTCTCAGTCGCAGGTGCGATACAACACCGAAGGTATGGAGCAGAA
GCCAAAGCACCAGCGTGGACCTAGCTGCTTGGCTAGAGTTGACCTTCACCCACAGCAAAGCTATGGTACAGTTTGGGAGGCATTTTATATGTATGTATAG
TGTGGGGAATGATGCAGCCTAAGCATATCTTCATGCGCAGAGCTGTCTTGCCGTCTAAGTTACTATCCTGTTCTACGCTCTCTGCAATCGCGCGCGAAGG
CTGGACAACTTGGGTCTTAAGAAGGGCGACCACGTGCACCGATGAATAGTTCTCCGTGTCAGATAATCTGCCAGCGCGGCTGTGGCGAAGAGTGCGGGAC
TGATTGTTGCGCGCGCGCAAATGCGGAAGTGATTCACCTGAAAATATACGTTTCCAGAGTATTTAAGGGATGGATTTTATCAAAAAATATAAGTTGTGGT
AGTCTGGTCGGTCCCAGATCGTTTGGCGGAGCCCCCCCCCCCCCCCCAGATTTTGAGTTTAGTCGAGGGTCCGGCGTGTTGCAATCAAGCCGAATACCAA
TACCGGCTTTGTACAATTAAAGACCTTCGATCATACCAGTAAGGTCTTTCGGGTATACATTGCTGGATGCAGAGACATCGGCTAGCCTGGGCTAGATAAG
ATGGCGAGGAAGGCGTAGTTTCCCGAGGTAGTGTGTATAAAGATAGAATCCACGGGAGTTGGTGAGCGCACCCAACCGGTGCTCACTTTCGATCTCTCCT
CCCGCAGCGAAAACCCCCAAGGTCTTCTCCCATCTCGGACATTCCAACGGCAGCGGTATGTCGCAAACTATTTCTACCTTCGTCCTGGCGTCTTCGGTGT
CGTTGGTTTTGCCTACGGCAAAGCGGAAGGCACTGTCGCTCGAGGTGGCAAGGTGAAGGTGAAACTGGTCTCAAGCGGACACTGGTTTGAGGAGCAGGGG
CCGACTGTCGAGTTGACTAGTGATGAGGTCACACCGATAACTGTCACCGTTGAAGAAGCACTCATTAGTGCTGGAACTTTCGTGGGGGCGTTATTTGCAC
CTCTCGGGTCAGGCCGGGAGGTGCTCGGGTCTGGGACTATGGTCTGGTCACTGGGTACAAGTGGTGCACCCAAGAAATGCGAGGTCTACTGGATATGAAT
TTCGGAGGGCTGAGTCAACCATTGTGTACACGCCAGACTCGACTCAGGACGTCACCGTCGAAATCTACGCCTTGCAGCCTTGTGCGGGGCTGAGCACAAG
CCTCGTCATGACCTCCGAAACGAAGAAGCAACACGAGACAATTTACAACAAGTTCAATGGAATCGACTGCCCTGCCACTCGTGACTCAAAACTGCTGTTG
GCTGACGTAGCAAGAAAGCCCATTGATGAAGCTCGATTGCTCCTGCTACTTGATATCACTAGCTTCGAGGTGTCCCAGGTGGCGGTCCGACATATTCTAG
ACTACGTATTCTTTAAAGAAGGCGAGCGTACTCACCCCGCCGGAGCGGAATTTGGTGATACCATCTTCGACGAGGTTGAATCTCAAAGAATTCTCCCAAC
GACGACAGCCAC