Description :
From Genome Similarity Track
Location :
scaffold_27:191943- 194836
Transcript NameFunction/comments
Plaha_PHALS_09402hypothetical protein

Sequence
2893 bases(100 bases per row)
GGTTAtatccgttgacacgtctcacacatgtgcacataggtgctcgttcatttgtacaagttgagccaccaatagtggtgactcactgagttgtacgttt
tctcacgaccgagatatcCActtagtggcgtatcgtgagcctcatagaggatacgatatttcaagtcctcatcatgaggaaccaaaattcgtggtgtatc
ctttgaatcggtgctataatatagcatacgttattcaacgaaaatcggtgcaatcgtgcacgcaatcttgatggcaatttgttgtccgagtttccaaact
ccttgctccctagagcccgtagcaacgctacaaacatcccatcaccagcatacgcggtgcggattaaatccgtcacagatgacgttacagttgtaacatg
agcaagctcatagtctggtctgcNNNNNNNNNNATCACCATCACcattcatcatcatcgtcgtCATTAGTCTCAACATCATAGCCTTGAATGCCCTCGCT
CGCTGCTTCTATCTGCAGCAGATGCGTCGTCCCTTCCTCTCCTTCTGTGGCAAGGattgttcttcttcttcttcttcttctcctcctccttcttcttctt
cttcttcttcttcttcttcgcttcttcttcttctatcTTCGCCTACTGACCTTCTTCTAGccaattttcttgtttgcTGCTTTATTACATATTTATTTAT
CGTCGAGATAATCCAACACCACTATGAAatagcagaagaagaagagaagaggtgATTAATGGGGTCGGTCATAGCAAGAGGTGGTGTAAAGGTACACATT
TATTATCAGCAATTATTCCTCTATGATGATCGTGTTGTTTGCTTGTTGCTAACGGAAGAAGTAGACGCAAGGTGAATGTGAAGTAAGATTGGGAAAGTAA
GGAAGAAGAACGGAGCAAAAAGGTTGGAGCACGATGAGTGAGAAGGTCAGTCAGGGCAGACAGTTATTGTTGTTTTTCATCGTTTGTCTCCTTAAATCCA
TCATTGACGCAACAAGAAGTTGAACATCATGATGATGTTATCCTCTTGCGTTCTCCTCTTTATACTACCGCCCAAGAGCGGGTGGAAGCTTAGACTCTTG
TACAACAGTGATGATCCACTAATACTTTGATTCCTTACAGTGAGCACAAggaaaataaaaattttCCGAGTAAGACAAGTAGCAGCATATATGTGCTCAC
AATAATCATCTCTCTTTTTATTCAAATGCGATGTTGAAAGGCTAGTTGGCAGCTACCGCTACTGCTGGTATATCATCATGGTAGAGTCAATCATCATCCA
CGCTGCCTGCAGTGAAAAAGTCAAGTCGTTTTCGATATCCTCCGCAGTAAAGATCCGGTCAGCTTTCCTATTATTCCCATCGTTCGCCTCATTCAAGGTT
GATGATCCGGTCGGAGTTGCTATGGTATAGCgcttttttttttgaaacaaaCTTCGATCGTCCTCCTGCCGTTTGCTGTACCTTCTTCGAATCAATGTGT
GGGATATCGTTCCAAGGAATGTGTTCACCATTGATGTATAAGAAGAGGATCATCTCAACGACGAAGGTGTCAAGGTTGGTTCTCCGTGGATTCAATAGCA
CACCAGCGATTCCAAAATCACGCTCAATACCCGCAGCTGAAGCAGGATTCCCAAAGATACATCTACCAACTGCAGCGAGACGAGAAAATCTGCCCTGGTG
TTTTATCCAGAACCCCACTCAGCACATCCTGAGGCTCAAAGTCATGCGGCATCACCAGTCCGCGGGTAAACTTCAGAAAGCTTTCTATCTCCTCATCCAC
TAGAATCCCCAAAAAACATCCGACTGAGGTATTGCCTGCCACTGAAGCTCTCCTATCATAAAGGCCCTTAAAGAGGTTTGCTGTTGAGACCAAGCTCTTC
CTAGCGCCCGCACGTTTCTTGCTAATGATGATGTGTCTCCTGCGCTCCGAATACCAGCGGAAGAGTTCGTACCTCTGCCCCTCCAAAGGTCATCTTTTTT
AGTGTTCTCTGCCTCAAACTCTGCACCACCTGCGGCCGATAGCTTCGTGGCCGCTCTTATTGCCATTCCTTTAATCTTGTCCCAAACATTTTTCTTCACT
GCCTCAACTAGCTTTGCCCGTTGTTGCTCCACGAGTTTTCCTTAGTAATGGCTGTCAATTACCAACTGAAGAAAATTTTGCTCCGTCAGGTTGGGGGTAA
GAGCGCAAGCCATTTCAAAGACGTAGGAATGTGGTCATTTGGCTTTGTCTTTCTTTGTTGAAGTCTCGGGAAACAGCTCGTGATCGTAGCGGACAAGGAA
TCGCTTCTTGAAGGCCTTCTCCATCAGCCTCCTAAATTTCCGTACAGTCTTCTCCAGCATATGGTGTTCTACAAAGAATGCGTCCTCCTTGCTCTCACCA
TTTTTGTCTCTTGAAGGTCGGGTGACTTGCAAAGGAGCTGCGGCTGACATAGTGTTCAGCTGGAAATCAACAAGACCAAGTAGAGCGAAGGCACCACTGG
GCTTGCTGCAACCTTAAGTTTTTTGCATCAGCGCTCCCACCGGGGCAATGAGGGAATAGAGTTGCCTTAACTCCTCCTTCAAAGACGACATCAGGTTGGA
GAGCTGTAGCCTTTCATCGTAGTACTTGTCTATCGGATGCTTAAGCTCCAAGAAGCACTTGATAACTTTGGTGAGGCTTAAGAAACGATGAGGGGCATGG
CTGATGACAGCTAAAGATGTGTTCATCAACTATTCCAGGGGCTCATAAAATCGCTGTTTCCCCTGTGGCGACTTGTTCAAGTGCTCGATGACACTACGCA
TCTTTTGCAGAGTCTCTTGGCAATCTAGATTCCCAACCTTGCTTGGATCCAAGTTTGTCGCGTATGATTCATGCAGAGCGCAGTTTGACAGAT