Description :
From Genome Similarity Track
Location :
Scaffold_2401:1919- 2927
Sequence
1008 bases(100 bases per row)
CGCGAACTATAAAATGCGTGCATCCAGGGAAGCCGCAGCCGGATTCCGCGTCTGTCCAGGTTGCGAGTTTGAGAACTTTCGGCGCTATGCGTTCTGCACG
CTCTGCGGCGAACAGTTACCAGTGGAGCAAACGGAGGCCGTTGGAAAGCACAAAACCAAGACCAAGACGAGAAGCAGCAGCAGCAACAACAACGAGCGCC
CTGCTGCCTCGATAGTCGAAATTGTGACCCCACGAGCTAAATCGAAGCTCCAGCTTCGCGTGAGGTAAGTTTTTGGATGTCACCGCAATTCTGATGAAGC
GCTGGCTACTCACTCGATTGTGGAAATTTGCTTGTTTGCTGGTTGTGACTTGAATGCGCAGCAAGCGCAAGCAGTGGGTGCGCAAAGTGGACGTCGACGG
CAATTTGTTCTGGTACCGCGGCTGTGTGGGATCTGAATCTGGCACTGGCGCTAATAGCGCTGAATCTCAACAGCCTGGGTATGTGGTCGTGTTTGAACAC
TCGGAGTCCGGTGCTGACGATGGCAACGAGCCAGTCGCTGTCGATCTCTTGCTCGGGGAGCGCGAGAGCCTCAGCCAACGCCAAGAACCCGCCGACGAGG
TCTCTAGTGTCGTAAGCGCAGAGCCAAGTTTGGATCCCATAGCCGCGGAGGAAGCGACCGAGCGGATGCCGATGATGGAGGGATCACATCAGATCAAGGT
GATCTCCGCATCAAATGCAGACTCCATGGTAGCAGCTCATCCGACCTTGAGTGCAAGCACGAAGGAGATCGTCGCGCTCGCTGCCAGAGACTTCCCCACA
AAATATGCGCATTTTGTCGTGAGCTCATCGTCGCTGATCGCCCCCGTCGAGCAAGAGTTCATCAAGCTGTCGGTGCATCGCGACTTTGTGCTGGAGGAGT
CCGTTGAGCACATCAGCTGCGTGGACAAGACACACATGCGGTCGTTCATGCGCGTGAACTTTTTGGACGAGAGCGGCGTAGATGCCGGTGGCGTGCACCG
CGAGTGGT