Description :
From Genome Similarity Track
Location :
Scaffold_7:1918226- 1920914
Transcript NameFunction/comments
Phyin_T30-4PITG_05256Putative uncharacterized protein

Sequence
2688 bases(100 bases per row)
GGTCACAGCATAAAAGAGACCAGCCGCGCTTCGCTTGACTGGGCACCCCTTTGGCGCCCCCGCGGTTCGCTGCGCTCGCAATATGGAGATAGAATGTACT
GGAAAGTGTAGTGCTCGGCTCGCTGGTGAGCTCAGTGTTGGGCCCGCCTCCGCAATACCGAACGGCCCAGCTTCGCGGGCTCCCCACGCGGGTTTGCTGC
GGCTACGCGCCTCGCACCCGCTCACCTTAGTTGGCGCCGCGGCTATGGCAACCACGTCGCCCAGCCTCGTGTGTGTTATCTTAGCGATGAGCGTGTGTTT
CTTTTATTTTCTGGCCTTGCACTACCTTCAAATCCTCTATACCACAACCCTTTATATAGTAAACACTAGATAAATAATCCAGCATATGCTGGATAATTAC
ACATTTTTCAGCCGAGAGTCGAAGATTATTGCTTGCCTCATGTGTAATTATTAATAAGTTACACATTTTTCGTAAGTGAAAGTCACATTTCATTTTTGCG
ATACGTATTATCTTATTGATCGTACACAGACCGGGCGGAAATTCAGTGGCCCCGCCCGACTTCAGGATATATACGCTGTCACCGTGGCGGTGATGGAACT
CCTGTGACAGGCCATTGCTACTCATCTACACGATGCATTCACCCTTCTGCTTATATACTTTGCTACGCTCTACTAAGGGAGCTCTGGACCACCACTGCTG
ACGCCCGCCACGACTGGCGATACAGCTCTAGCGGCAAATGCGGGCAGACCAACTACTCGCGTTGGACTACCAAGTCACGACCGCTCTTGCTTGCCCTGAA
GAGCTGTGAGGTGTGACGTCAACAACACCTGCCGTCTGCAGCTCCACCGCAGTCCAGCTCGTCCAAATCCCCTGTAGCAGTGTGGCCGTGGCAGTTCTGC
TCAATACCGAGGCTACTATGAGTCAAAGCAAAGCACTATCGGTGGGCATATGGAGAGATGGTTCAAATGAAGAAGAAATAGAAGAGGACATCTTCTTTTG
GAATGTTGCAGCTACGGTTGCAATGAACTCTCGTAAAAGTCGTTATTACCGTCAGCGGATAATTTGGAGCTCTCCTGTTTCTACACTTCGCAGCCAAGGC
ACATTTCACAGGAAATATCGCGTGTGTGAGCGGACTTCGAGCAACGTCTCGCCGCATTGGGCTCAAGCCTCCACGTGGACGCGTACATGTCGATACGCAC
GGGAGAAGCACCACTATCATTCTTAAGTACGAAATTGTAATGTACCGCATATTCGGCTGGCTAGCTGGGAGTCTGCTACCTCGCTTTTTGGGGAGGTGAT
ATTCGGCTGGGTAGCTGAGTCTCCCACCTCGCATTTTGAGGAGTGATATTCACCGGAACCTCTCCGCGATTCGCTGGAAGGTAACGAAAACGAGCCACAG
CTTCAGAATCTCAAAAGCTAAAAAGAGCTAAACATCGGGGGATAAACGTCCACAATAATATCAGTCAAGTAAAATCGTTGAAATCGAGTAAGGATCTGTG
GTAGCTCAAAACAGCAGCCACGAATAAAAAAAACAGATCTATGATCACACCTTGTGATATCTATGATTTACTAACAGGATCCGTGACCTCATCAAACCAT
ATCCATGAATTACATATAGGATCAGTGTGATTGTCAGCCAACATCCATGAATTAAAAAAATGATCCTTGAAATCTGAGCGATTTATGAACGAATGCCAGA
TATTTATGACCACGCCGAGCGTATCCAGGTAAGTAAAGATTAGAGATTCTGGCATGGGATATCATTGACGCCGGCACGACCAGCATTTTCGTGCCCGAGT
GCAGCGCCGCCATCACGGTGGACTGCACCGATCCATGCTTTTCAATGGCGGCGGCAGTCACGGTCTGCTGATAGGCGCGATGGAGGTGCTCCGGGGCGCT
ACCCTGGATAACCTCCACAATGCCACACTGCTTGTCGGCAGATGCATTTTCGACGAAACGTCTACGAGACGCTCGTAAATAAGGCGAAGAGTAGCTGGAT
TGGCGTTAATATTATCACGCATATTTAGGAAGGCCTGTCTGCGCTTCTCGTTTTCGGTAGACCGAAACCACTTGTTCTCAGGTAGATCAGCAACGTCGTG
GAGGGACATGTCGACTTCATCTTCACTTTAAAGCAGCGTAGGACGCGGTAGCCACGGTTCCACAGGTTACTGAGCATAGCGATCTTGGCAGGGGCTCTCA
TGAGGGAAGGACTTGAATTCAGTTGTGAGATCTGGCCGGCAGCTCATGGATGGCTGTCGGCGATGAAAACTAATTTAGTGTGACCAACATTGAAGGATAG
GCATTCGCAAGGTGTTGATTTCGCCAAACCTCGTCCTTAGCCATTTGATTTTTGGCTACAGTACACTTTATTTACTATACCTTCCGGCGAATAGAGGAGA
GGTTCCGGTGAATATCACCTCTTGCATTTTTGCAATGCTGGACACATCAGCTCTACTCTCCCTACCGATATATGTACAAAGAAGTTCATGCTATCATCAA
GGAAATGTATCTATGATGGGTACTAGGCGTGAATGATCTTCATGCAAAATCGGGCAACGAGAGTCCCGTCGAGACCAAACTACTCGAACAGCTGCTCTAT
TAATAAGCTCTTTGCTGTTGGTCGTAGTGCTCTGATTCCAAATAGCCTTAACCACTGATATTTTTATTAAGAGAGAGTTTCGCACAAC