Description :
From Genome Similarity Track
Location :
Scaffold_3:191760- 192899
Transcript NameFunction/comments
Hyaar_Emoy2800552hypothetical protein

Sequence
1139 bases(100 bases per row)
GGTGCACGGCATCCGAGGACCGGAAGCTCCGGGCCGCTCGGAGGAAGGCGCCTGCGGGTTGTAGTTGAAGCACGTCGCACATGGCGTTGTTTGGTTGTGG
GATAGGGAAGTAGGTATTGACTGCTTTGTCTGTTGTTTTGGTGGAGTCAATTGCTTGCTTAGCTGGTTGTTGGTGGGTTGATTGGTTCGTGGCAGAACGA
GCAATATGAGAAATGAGGACGATGTTTAGAAAGCACTTTGATTGTCGCGTCTATTGCGCGAAACCGTTGACGGGATAAGGCCATGCGTTATCGTACTTAT
TAACCTACCGTTTCTATTCAGGTTCGTACAAACCTCTTTATTTAAATCTTAAGCTTACATTTATTCCACAAACGACGGTTATGGTGATAAAATACCTGCA
ATATCACATACGCTATCTACAGATGGAAAAGCAAACAAGACATTGTTTTTTTGTATTACCAGCATAGTAAGCGCGAGTCAGTGACGATCATAAGAACATT
CCCGTGACAGCAGCTAGGTGAAGAACAATTACACTTTATCCAGGAGCTTTAGCCCCTTACATCGTGCTGGTTGATGCTACGTCATTCGGAAACGAGTCCG
CCAGTGAGGATGGTCGGGCGGATAAAAGTGACAACTTGAACCACAGCCTGTCATTCAACATACCACTCGAGTCTACCGCTGACCAGGTTCAACTGCCCGT
TTCTACACCGATGAAACTGTGGTCATCGAATGACTCGCCCCTCTCAGCTGAAAACGCCTTCGCCACGGCAAGAACAACACCTAATGGCTAAGCACTAGCC
ACACATTTCTAGATTTTCGTTTGCTTCATGCTTAGTTTCTCCTTGCAGCGAGCAAATGCAGCATCAGTTCGCTTCGTATTGAAACATTTGACGACACTTG
TGGGGTCGACGGGCATCGTCTCAGACACGGTTGAAATCTGTCGGGGTGCATCAGCAAATCCCCCACCTGCAACAAGCACGTGACAGGAAAGTGTGAGTCA
CCTGCAACTTCAAGCGTTTTGTAAGCTTCTCGGCACGCCATTCGGTCCCAAATTATACCGCTCGCAAGGACATATGTCAGGTCCATTAATTATCCTGGAA
AACTGCCGCTTGCAAAGGAGACTCAGATAGTTACGTACG