Description :
From Genome Similarity Track
Location :
Scaffold_574:19175- 20177
Transcript NameFunction/comments
g15451.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
GCGACCGGGAGAGAACTCTTTCGTCAGCGAGTAGGAGCAGATACATGTAACAAGAAAATAGCGTTGTTTAAAAATGGGCACACACAAACGATTGATAAAA
TCAAACCTGCCAATTCGGTGTAGGCAACAAGTACCAAGGTGATGCAAACCAGCACCGTACCTTCGAAAGCCGATGCGTGGGGACCAGCGACAGCAGGGAC
AAAAAGGAGGTTAAAATCTACGCTCACAGTACATGTGCACTATACAACTAAAATGTACGATCCACAGCAATCGAGCTCTCCTGGTCATGATGCTGCTTCC
CCACGAACGAAAAGCTTTTGCATCCCCTCTCAGAACGCATAGTGCGACTAGCGATGACTCCCTGTTCACGCGGCAGTCTCCGCGTCGGTTTGTCATAACC
AGGGTAACGAACCACTTGGTGCTTATCTCCCCCCCCCTCCCCTCCAGGCTTCGAAGACGTCGAGGTCGACTACAATGTATGTGCCCACACGTTCACCTTC
ACGGATGCGTTCCTTCACTTGCCGTTGGCTGTTGTAGCCGAGCGGTGGTTTCGTGGCCGGCTCCCCTGGTCTGGCCTGGGGTGCAGCCAGTGTGCCAGGA
AGCCGTGCCTATCAATGTCGATCATCAGCGGCGTGTGCGTATATCCCTGGAGCAGTTTTGCGTAAGTGACCGGACCCAGAGCCTTGTTCGGCCTGCTATC
GCCCGCTGTTTCGCTTCGCACCAGCTGCACTACGTCACGCAACGATAAGCCAGCCCGACGAAACAAGTTGGACAAAAAGGGTTGCAGGCTCGTAGTTTTG
CCATAGATTAAACCATGCTGGAATGCACAGTTAGCGATCCCGGTGACGACAGTCATCTGGGTGGCGCGTAGCTGGCTGGTGAGTCGTGTTTGCACCACCG
CAGCCATGGGCAGGTACACATGCAGACTGGCTGACGGACATCATAAGTGCCTAAAAGATGGACCCAGACCTCCGAGTCGCTGGTTATTGTAACCGCGGAC
GT