Description :
From Genome Similarity Track
Location :
Scaffold_112:191733- 197120
Transcript NameFunction/comments
Phyci_156287Hypothetical protein
Phyci_239624Hypothetical protein
Phyci_239637Hypothetical protein
Phyci_161400Hypothetical protein

Sequence
5387 bases(100 bases per row)
GCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGCCACCGTGAAGGACGGTTTCGATCCAAAGCTGCTCGAGGTGGTCAGCCT
CTACGAGCTGCAGACAACAGTGGACGAGGTGACGGAGGACCAGCTGGTCACGCTGATCTATGACCGAACCAGCAACGACATGAACGAGTTCGTCCCGGAC
CTGAATGGGTTCTTCCGCAAGCATCTGAAGATGGACCTGAAGGAGGTTGACATAGATGCCCGGGTCCTGAAGTATTATCGTGACTTCTCGGAGCTGATTG
AGCAGCACGGCTTTGGCCGCCTCCTCGGTGTGGGGCTTCCGAGTGACAGCACGTTTGGGAATCGCATGAAGTTGAGATGCAAGATCTTGCTGGACAACAT
GGAACCGCAACTCCTGCGTGATGATGTGCGGTATGTCCAGTATAAATGCCGCTCCGCCAAGAAGAATGACTTCGAGCTGTTTCGAATCATCAAAGAGCGC
GCAAGGACGCAGCACAAGTACCACGTGCTGAAGATGGAGTACAAGCAGAAGGTGGAGAAGAATAGCGACAAGAAGCCCTCCACCAGTGACTCCAAGCCCC
GCTAGGAACGCGAGCAGCGTCGCGGTGGAGACAGCGAGAACCGAAGACTGACATGCCGCCTAAGCGAGGCACGAGTGCTTCGCCACCTGCGGACGGCTGT
CTGCACTGTGGAGGCGGTCCTGGCTCCGCAGTTGCCCTACTGCCTCCGAGGATGATCGCCGTCGCGCCCTCGAGAAGCTACGCTCGCAGCGTGAGGAGAC
CAAGCTGTGATCCAAGACGGTGCGCAGTGGCCTGCGCAGAAGCCCCAAGACTGGCGAAGTGCTCGTGAATGAAATGGTGGTCGCGCCGTATTGCCCTGAT
TCGGGATCGCACCGCAGTGTCATCCCGAAATCCCTGGTCGATGAGCTGGAGGAGCTGGACTGAGATGCCAAGCTCTCAGCACTTCCTGACCCTGTTATAG
TGACTGTGGCTGGTGGTGGCCAAATCGAGTGCACGATGGAAGCGGAGACTAACTTGCAGTTGCAAACTGCCGCAGGCATGGTTCGTGTTTCAAGTGTCGC
ATGTCTGGTAATGGGTGGTGGTGAGACTGAGTTTTTGCTCGGTGATGACACTCTCAAATCACTAGGAATCGACGTACATCGACAGCTGGAACTGGTGGAG
ACATGGTGGCCGATGACGACCCCTTTGAGCCTGAACCACCTGCAGCGGACACCAGAGTGGCGGCGCGACTGGAAGACATGGTGGACGATGTATTACGTGA
CGTTTTGATCCCGATTTGCATGGGGAACTGCGGTAGCTGGCGCACGAGTATCAAGACATCTTTGCAATTGACGTCGACGATGATCCGCCTGCACTGGTGG
AGTCGCTGACGGTAACGCTCAAGCCCGACGTGGTACCTTTCCGCGCGGAGCCCCGCAAGCACGCGCCGGCGCAGCGTGAGTTTCTGCGTCAAGAACTGGA
GCGCCTCAAGACACTTCGGTACATCCGTAAGAATAACCACAGTCGATGGGCCTGTGCAGTCGTTCCGGTCGCCAAGCCGGGGCACAAGATGGACTTCCGA
ATGACCATCGACTACCGCCCAATAAACAAGCAAACGGTGCCCATCGCTGGAGCCGAGCCCAACATGGATACCATCACGCACGCGGTTGCAGGTGCCTATG
GATTTTCGGGTTTCGACTTGCCTAAAGGTTTTTTTCCAGTTCCCGCTTGCTGAAGCAAGCCAGGAGCTGAAGAGCTTCATTTCCGAAGACACCGTGTATT
CGCCTACTAGGGTGCCCCAAGGGGCTATGGACTCGTCTGTCCATTTTCAAAATCAGATGCAGAAGAAATTCGCGGACATGCCGTATACTAGCCTTTTGTT
GTGGATCGATAACATTCTAGTGCACGCCAAGTCGGCCCGCTCTCTCCTCGACGCGCTCCGCAGTTTTTTCGGCCGGGTCCGCACCCATGGTCTACGCCTA
AGTGCCgtgaaaagttgtttgttcaagaaagaagcgaagtggtacggccgaatgatcagcggtgagggcattttccacgatccggcacggttgcatgctc
tcgcaacgctgccactgccctcgaccggtgccgatctacagcaattccagtgcgctgccggctggctgcgcgaCACCCTGCTCGACTACGCTCGTGTGGC
AAGACCGCTGCACGACAAACTAGAATCGGCTCTTGCCACTGTGGGTCGAACTCGCCGTCTGGCGGCTGGTGTCGTCCTTGACTGGTACGACGACGAACGC
TTGGTTTTTGAGGATCTCAAGTCACTGATCGCTTCGTTCCAGCCGCTGGCGTTCCCGAGTGCTGACAGCGACGTTTGTGTATTCACCGGTGCCTCCGATT
CCGGCTGGGGCCTCATTGTTACCCAGGTTACCAGTTGGAACGACGCCCGTGGGAGCAAGCCCATCAACTCCTGCTTTGCAAAAGCGGCATATTTTCCGGT
GCCGCCAAGAACTGGGCTATCATCGACAAGAAAGCTTTTACCATTATGTGGGCATGCGTTCATTTGGAGTACCTCCTGCTGCGCAGCCGTGGTTTCCGAC
TCTTTTGCGACCATAAGAATTTGATTAACATCTTCGATCCATCCCTAAAACTTAAGCAACACATTAGGGGGCGACTGCAACGTCGGGCTCTCGCCCTTGC
TGGACTTACTTACCTGATTGAGCACATCGAGGGCGGCAAGAACGACTGGCCCGATTTGCTCTCTCGGTGGGGCTGCTCTTCTTCGGGAGAAGGTGGTGTT
GTCACGCGGTGCAAGGCCATCACCCGCAGCAGTACGCGAGCAGAAAACAATGCTATGTCTGCTGAGAGCAGCCTGCGACCACGGCACGATGGATTCGTCT
TCCCAACCCTTGACAAAATCAGGAACGCGCAGCAAGAATATCGGCGGGCAAAGCCGACAGAAGCACTTCCTAATGATGATCAACTTCTCGTAATGGAAGA
CAAGGTATGGCTCCCAGAGAGAGCCAGGAATCTGGTGCACTGAGTGATGATGGTGGCGCATTGTGGCAATCAAGGTCATCGCGGCCTGGAGCCGATGCTG
TACACAATTCAGCAAGTATGCTTTTGTGCGCGAGCTCCCTAAGCCATGTCGGCAATTTCTGAGCCGATGCTTGCTGTGCAAAAACACCAAAGGTGGCAAC
ACCATTCCGCGCCCACGGGGCCTGGCATACCAGGCTACAAGACGCAATGAGGTCCTGCACTATGATTTCCTGTATATGGGAGAGAGTAGGGGCTCGACGC
TCTACGTGctggtgctcaaggatggcatgacacacttctgcgagttgattgcgtgcgactcgccgactagcgaagttgcggttcaagctttgctggattg
gagtaagcggtttggtgccccggaaattctcatgtctgacacaggttcccacttcaagaacctcgtggtcaatgaactgtgccaacgcctctccatcgag
ctggaatttgccgttgcctactcaccctggatcaacggatccgtagagcgcatcaacagggacatcctgcaagtgatgcgcgtcatgctcatggagctcc
agctggacacgagggaatgggtgtacttgctgccgttggtgcagtctaatctgaatcacatcgttgtgcccagcctgaacaaccacgctccaaatgagct
ttttacGCTACCGCCCGTCCCGAACCCCCTCGAGCCAATCGTCGTACCAAGGCCTAAGAAGAGTTTGATCCTGGACGTTGCGGTCATCGTGACAACATCG
ATGACTTGCACGAGGCATTGCATGCCATGCATCACGAGGTTGCAGAGACCAAGGACGCGCGTAGACGTCTGAACAAGGACCGGTCCACGGGCACGCCATG
TAACTTCAGCGTGGGCGACTTCGTTCTCTGGTCGAGGATCGACAGCCGCCTTTCAAACAACAAGCTGCTTGTCCGTTGGGTGGGACCCTTCGAAGTGGTC
AAGGCCCTGCCCCACTCGTTCATGGTGCGCCATCTCATTACTAGCAAGCTCTACAATGTCCACGGGTCACGGCTGAAGTTTTTTAcg