Description :
From Genome Similarity Track
Location :
Scaffold_144:19172- 23785
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_14935ABC transporter lipid exporter ABCA1 family

Sequence
4613 bases(100 bases per row)
GACAGGCGCGCCCTCGTCGACGTCGTCGACCTTCTACTCGAGCGGGCAGCCGGTCTTTGGCATGTTTTCTTGCTGTCGTACCTCCGCTTTGTGCCGTCGC
TCACGTCCAAGATCGTGCTCGAGAAGGAGAAGCGGCTCACGGAGGGCATGAAGATGATGGGCGTCTCGGACGCGGCGCTGCGCCTCTCGTGGCTCCTCGC
CGACCACGCCGTCTACACGTGGCTCGCGCTCGCCATGGCGCTCGAGCTCAAGTTTGGCCACGTGTTTCCGATGGCCGACCTCGCGACGCTCTTCTTCTTC
TTTGCTGCGTTTGGTCTCTCGATGGTCTCGTTTGCGCATCTCATGAGCATCTTCTTCAACAAGTCCAAGACCGCCGCGATTGCTTCCGTCTTGGTGTGGG
TCCTCGCCTTCCTGCCGTTCTACGCCGTGGGCGCATCGTCGCATACGTCGCAGTATGCCGCTGCGCTAAGTGCCCCGACGGCCTTTGCCCTCGGCATCGA
AGTCCTCACGCAGCAGGCGCAGCGCGGCACCGAGCCCTACTACAGCATCGCGTCGACGCAAGCCACCGGCGGCAGCCGCGTCAGCGACATGACGTGGTTC
CTTCTTAGCGACGCTGTCTGTATGCTCCTGGCGTGCTGGTACTTGGAGCAAGTCGTGCCGCAACAGTACGGCGTGCCCAAGCCCTGGTACTTTCCGCTGC
ATCGCGCGTACTGGGCTGTGCGGGGCAGAGCACCGCGCCCGTCTCGCCGCCACTTCACCGCGCGCTTCTCCGATGCTCCCGACTATGACGAAATGGCGAC
GCCAAGCACGCGTGGTGCATCGCCCTTGCATCAGGCCAACGTCGAGCCGCCGACGCAAGCCTTGCGTCTCAAGGAGCAGCGCGGCGAGTGCGTCCAGCTC
GTCGGTCTCCGCAAGACGTTCAAGACGGACGACGGCGAGAGCAAGGTCGCGGTCCACAACCTCCACGTGACCATGTACGCTGGCCAGATCACGGCGTTCC
TCGGCCACAACGGCGCCGGCAAAACCACGACCATCTCGATGCTCACGGGTCTCTTTCCGCCGACCAAAGGCACGGCCTATGTCTTTGGCAAGACGATCAC
GGACGACATGGACGCGATCCGCGCCAGCATGGGCGTCTGTCCGCAGCACGACGTGCTCTACGACGAGCTCTCGGTGCTCGAGCACCTCCAGCTGTACGCG
GCGCTCAAGGGCATTGAGGACGCAAGCGCGCAGATTGACGCGATGGTCGCCGAGGTCGGCCTGGTCGAGAAGCGCCACGTGGCCTCGGCCAAGCTCTCGG
GCGGCCAGAAGCGCAAGCTCAGTGTCGCGATCGCGCTTCTCGGGAAGAGCCAAGTGGTGTTTCTGGACGAACCCACCTCGGGCATGGACCCGTACTCGCG
CCGGTACGTGCTTGGATCGACACTTGATAGATTGATATATAGCTTGGTAGGTTTACGTGGAATGTGCTCCAGCGCAACCGCGAGAACCGGGTCATGGTGC
TCACGACGCACTTTATGGACGAAGCCGACTTGCTCGGCGACCGCATCGTCATCTTGTCGGACGGTCGGCTCTGCTGTGCGGGCTCGTCGCTCTTTCTCAA
GCAGCTCTACGGCACGGGCTACAACCTGACGCTCGTCAAGACGAGTGCGTGCAACGTGACGGACCTCGTGGCGTTTCTACGGCGGTTTGTGCCCGACGCC
AACGTCCTCAGCAACGTCGGCGCCGAAGTCGTCGTGCAGCTGCCGACGCACGCGAGTCCGCAGTTTCCCGACCTCCTCCTCGCTTTAGACAACGAGTTGG
AGACACGGGGCATCGTCGAGTACGGCATCTCGATCACGACGCTCGAAGAAGTCTTTTTGCGGATTGCCCACCAAGGCGACGTCAACGGTCCGTCCGAAGC
GCTCGTCGACTGGCACGAGAGTCCACACATCGTACTCGAGAAGCCGCCTCGGGCAGGCGCCGATGCAACTCGGCCGCCGTCGTTCCGACAGCAATATGTC
GCCATGCTTCAAAAGCGGTACGTCAATTTTCATGTGTAGAAGTCAAATTTTCTGCCTCCAATTCACAACAATGGATACTGTAGCTGGCGCGTTTCCCGCC
GCGACAAGAAGAACATGATGTTTACACTGGTCATCCCCGTGCTCTTCCTTGGGCTGCTCGCGCTGCTGCCGTCCATTCGCGTCGCGAGCTACCTTCCGTC
GTACGCGCGGGGCGTCAGCGTCGAAGAGGTCGAGAACTACAAGGCTTGCAATATCGTTTTGACCAGCTCGACGGCCAACTACGAGTGTGCCTACGGCATC
GCGACCGCCGTGTGCCCCAACTGCCAGCCCTTCGTGTACGGCTGCGGTGTGACCAACTACTGCTCGGAAGGCAGCATTCGAGGCAACTCGTCATCCCCGT
ACTGCGCCATGGACGGTGGCTTTCTGCGCAGCACCAGCGTCTGCATGACCGAGTGGTTCAGTCACTGCTCACTGGGCCTTGCCGACTGCGATGCCACGGC
GTGCTGCGACGCCACGAAGCCCGTCTCGCCCTACTATCCGTGCTCGAGCTGCGCGTCCAACAAGTGGCCGTGCTATAGCGGCAGCTGCATCGTCAAGAGA
GACGCCAAGCTGCAAGGCCAGATCAACACGTTCCTCGCCTGCCTCATCATTGTCATTGGCTTTGCGTTCGTGCCTGCGTCCGTCGTCGTGTTTATCGTCA
AGGAGAAGGACCCGCACCAGAACGCCAAGTACCAGCAGCTCGCTTGCGGCTCGTCCGTCTTTGCCTACTGGTTTTCGATTTGGACCCACGATGTCCTCTT
CATGCTTGTGCCGGTCGCCGTCGCCGTCGCCTTGCTGCCGTCGTTTGCAAGCTTTCAGAACGACTCGGCGTCCATTCTCGGAGGCCTCGCCCTTCTTCTG
ACGCACGTGCTCTCGATGCTGCCGCTCGCGTACCTCTTTACGTTTCGGTTCACAAAGCACGCAGCCGCACAGACGTCCGTGCTGGTGTTTTGCCTCGTCA
CGGGCGGTCTCCTCAGCATCATCTCGTTCCTCTGCCGCTTGATTGACTTTGATCTGATCAAGAACCAGCTCACGCTCGCGCAGCTCGACACACAGTATCT
GCGCTGGGTGTACCTGCTCTTTCCCGGGTACGCGCTCACGGACGGGCTCTTTCAGATTGGCATGCGCAAGTACGGCAACCCGTTTGGCGGCATGGGAGCA
GGTGCGTGTCCGATCGAGCAATCGTGCTGGAGTGCCAACGTCCCTGGGTGCTGCACAGCTAATGTGTTTGAACTGTCTGTCGCGGGGCGGAGCCTTCTCT
ATGGGGCCGTCGAAGCGGTGCTGTTGACGCTCTTGGTGCTGTACGCGGACCGCCAGCACACCGCCCGGCTGCCAACCAAGGCCGATGACGCGTACCGCGA
ACGCGGCAGCTTGCTGGAGCCAGACGTCGCAGCTGAAGCGGTGCGCGTCATGCAAGGCCGTGCGAGCGGCGACAATGTCGTCCTGCACAAGCTGCACAAA
CAGTACGGCGCCGAGAAGATTGCGCTCCACCAGCTCAGCCTCGGCATTCCAAAAGGCGAGTGCTTTGGCTACCTCGGTATCAACGGCGCGGGCAAATCGA
CGACGCTGCAGATCCTGCATGGGGCACTGCAGCCAACGTCGGGCTCGGTCACGGTCAATGGCCACTTGTTGCCCGCCGAGCTCCGCGCGGCGCGGGCCTC
GACAGGCTACTGTCCGCAGTTTGACGCGCTCCACGACCTGCTCACGGTCCAAGAAGAGCTCGAGCTCTACGCGCGCCTCAAGGGTGTTATCGATGTGAAG
GCGGCGGTCGCCGCCAAGATGGACCAGTTTGGCCTGCACGCGTTCAAGGCCAAGCGAACGCAGGGCCTCAGCGGCGGCAACAAGCGCAAGGTGTCGACGG
CCATCGCACTCTTGGGGTCGCCGACGCTACTGCTCTTGGACGAACCGTCCACCGGTATGGACCCGGCCGCGCGCCGCGACATGTGGGACGTGATTGTCGG
CGTCCTGCAGGAGAAGAGTTGTTCGGTGATTTTAACGACGCACTCGATGGAGGAGTGCCAAGCGCTCTGCACGCGCATCGGCATCCTCGTGAGCGGCCAG
CTCAAGTGTCTCGGCACGGCGCAGCACCTCAAGCACAAGTTTGGCCGCGGCTTTACGCTCGACCTCAAGCTCGAATCGCTGCCCGAAGACGCGTGGCCAG
TGCTGCCGACAGCGTCGTCGATGTTGACGATGGACGACATCGTTAGTCTCTGCAACGAAATGGACTGTCCAGAACGACTGGAGCGGCTCCAGTCGGACTG
GGTCCTCCAGCACTACGTTGAGAAGGACGGCGGCGTGCCGCTCGATGTGCTTCGGCAGTGGTGGGCGACCGATAACGCCAGCGACGCGCTCCTGCAGCGT
CTTGACGCGGACGTTGAAGGCGCTACGCTCATCGAGCACCACGGCGAGCACTTCCGCCTCCACGTAGAAAAGGCCTTTGGCCACACGCTGCATTCGCTCT
TTGCGTGGATGGAAGGCCACAAGAAGGCCTTGCACCTGGCGCAATACAGTGTGAGTGATACGACGCTGGAAGAGATCTTCAACGACATGGCCGCGAGCCA
AGACGAAGAGAAG