Description :
From Genome Similarity Track
Location :
Scaffold_1454:1917- 4910
Transcript NameFunction/comments
Phyag_g10671hypothetical protein PHYSODRAFT_559234

Sequence
2993 bases(100 bases per row)
GGCTACTGCTCGAATCTGGTCATCACCAGTCGCTTCACGCTCTACAACTTCCTGCCCAAGCTGCTCTTCTACGAGTTCAGCAAACTGGCCAACGCCtact
tcctcgtcatctccatcatgCAGACCATCAAGCCCATTTCCAACACGGGCGGCTTCCCGGCGTCACTACCGGCGCTGTCTATTATTGTGCTCATTGACAT
GTTCTTCGCCTGTTTGGAGGACTACAAGCGACACAAGGCCGACCACATTGCCAATAATATGCCGTGCCAAAGGTTTAATAGGGATGCAAAGGCGTTTGAA
GCCGCGAAATGGCACTCGCTGCAGGTCGGAGATGTAGTCAAAGTGGCGAATCGAGACCCCGTGCCGGCGGACCTCGTTATTTTAGGGGCTTGTGAACCGG
AACCCACCAACCCCGCGGGGATTTGTTATGTGGAGaccaagtcgctggatgGAGAGACCAATTTGAAGCTCAGACAGGGACTGGAAGCCACGTACACGGC
ATTGTTGAGTGATGCTGCGGTGGGAGACTTGAAGGGAACGGTGGTGTGTGAGACGCCGAATAATTCGATTCACAGGTTTAGTGGGTCGATGACGCTGGAA
GGAgggaagaaggaggtgatcACGACCAATGCCATTGTGCTGCGTGGCTCGACGCTGCGTAACACGGAGTACATTTACGGCTTGGTGGTGAACACGGGCC
CGGACACGAAGATCATGatggcctcgtcgtccgagccCATGAAATGGAGTAATATGGAAAGGCGCCTGAACAAGCAGATCCTCTACATTTGCATGCTCAT
GGTGGCGCTGTGTCTAGCAGGTGCTATCTTGTCGACGGTCTGGAATTCTCAAAACCTGGACAAACATGTTCATAAGGCTGCGTGGTATTTGTACGACGGA
GGGTCGACCGCTGTGAAGTCGCCTGTCGGAAACTTTTTCATCATGGTGTTGTATtatttcctgctgctgaactCATTTATCCCGGTCTCTTTGTACGTCT
CGATGACGTCTGTGAAATTTATGCAGTCGTACTTTATGAACAACGATCTGGAGATGTATCACGAGGAGACAGATACGCCATGCCAAGTCCGCACGATGTC
TTTGAATGAGGAGCTGGGACAGATCGACTACATCTTCTCGGACAAGACTGGTACACTGACGTGCAATATTATGGAGTTCCGCAAATGCTCTATTAATGGT
GTGGCATATGGCCACGGTGAGACCGAGGTGGGTATCGCGGCCAGAAGGCGTCTACAGGAAGAGGCACCCACGACATCTTCGTTCTACGCAGTGACTCCCG
GCGGTGGCTGCCCAGTTCCGATGAGGAAAGACCGCGTTGATACTGGAACAGACTCAAACAACCCGACAGATCGTGTGGTGAAGGCACCGTTTGTAAACTA
CCAAGACGACGCACTATTTGACGCGCTGGCGCAGAAGAGTAGCATGCAGGCAAAGGCAATCGGGTCGTTCTTTGAGCACCTTGCAGTGTGCCACACCGTC
ATGCCCGAAAAGGCCCCGGACAATAGCCTGCGCTTGAGCGCATCTTCTCCCGACGAACAAgcactcgttgctgcagctgcctgCTTTGGCTACAAATTCG
TGGCGCGTGGGCCCGGCAAGGCTATGGTGGAGTATTTCTCGTGCGTGGATCACCCTGAAGATATGGTTTGCAACCAGCCTGTTGCAGAGCACCCTGTGGG
TAGTTACGAGGTCCTTGAGGTCCTTGAGTTTAACAGCACGCGTAAGCGAATGTCTGTGATCCTGAAGGGTCCAAATGGCGAGCTAAAGCTGTTTTGCAAG
GGAGCTGACACTGTCATGTATGAGCGCCTGAGACCGACCAATGACCCGACTGTCAAGCAGACACGCAACCTCACACTGCAACACATGGAGCAATTCGCGT
CCGAAGGACTGCGTACGTTAGTTATTGGATCGACCGATATTGACCCGAAGTTTTTTGAGTCATGGGTGATCCGCTATCGGACAGCTATCAACGACATGCG
TCAGATCGATCTGCGCCGGAATGGCGAGGATAACGACATTGATCGGCTAATGGAGGAGATTGAGGTGAACTTAGACATCTTGGGTGCCACAGCTATCGAG
GACCGACTGCAAGCTGAGGTACCCGATACAATTTACAAGCTGCGCCAGGCGTCGATCAAGATCTGGATGCTGACAGGTGACAAGGAGGAGACCGCTATCA
ACATCGGCTTCGCCTGCCGTCTATTGGCCTCGGACATCGAACGAATCGTGATCTCGGCGGATACACACCCTGACTTGACTGCCATCattgacgagctgga
agccTACAGCCGTGACATCGACAACGATGACACTTCTGCATCGACACCGGCTGGGGGGCCAGGTGCTCTTTCGGTGATCTCAGATAGGCAAAGCACGGTT
TCGCTCAGAAACCAGCGCAAACGATTGACCCGTATCGAGAGTTTGGCCGAGATGCCAAAGCAGGATCTGGCTTTGGTAATTGATGGTGAAACGCTGGAGC
TTGCGCTGGAAGAGTGCCCTGAACTGCTTTTGAAGGTAGCAGAAAAGTGTGTGGCAGTAATTGCTTGCCGTGTATCGCCTGCTCAGAAGGCGCAGTTGGT
GCGGCTGGTTCGTGACAACAATCCGGAAGTTCGAACGCTGGCAATCGGCGATGGTGCTAATGATGTTTCGATGATTCAAGCTGCACACGTGGGTGTTGGT
ATCTCTGGCCAGGAAGGTATGCAGGCTGCAAACTCATCGGATTATGCCATCGCGCAATTCCGCTTCCTGTCGCGACTGCTACTTGTCCATGGACGCTGGA
ACTACGTACGCATGGGCAAACTTATCCTGTACATTTTCTACAAGAACGTGATTCTGAACCTGACGCAGTTCTGGTACATGATCTACACGGGCTACTCAGG
ACAGAAGTACTTCCTTGAATGGGGACTTCAGGGGTACAATCTACTCTTCACAGCGTTGCCAATCGTCCTGGTGAGCACTTTCGAACAGGATGT