Description :
From Genome Similarity Track
Location :
Scaffold_134:19164- 24003
Sequence
4839 bases(100 bases per row)
AGGAAAAGAAGGGGAGAATCTCCTCCTGTGGATTAGGGAGGTGGAAATGGCTATGAACTCTACTGTGCTCCAGTCGGAGCAACAGCGAGTTGGGATAACT
ATCTCGAAACTAGGTGGTAGAGCCAGAGAATGTGCTATCACGTGTAGCACGTCGGTAGACGAAGCTTTCCCCACATGGGGTTTGCTAAAACAGCAAATAT
CCCGGGTGTTCGCTCCGCCTAATCAGGTATACCGGGTGCGTTATTTTCCTATCTGCCCGTCAGGGCAAGAAAGAACTATCGGGCTATGTCCAGGAACTGA
GAACTCTAATCGCTGCCATGCAGCTCGATCCCTTACCAGAAATGGTTTTGGTTCAATCTTCATGGAGAGCCTTCGTACGGGCGTGGCTCGAACGGAAGTA
TTCCGGGTACACCCCACCTCCTTTTTTGAGGCAGCTGTGGATATCGCATTGAACGCTAAGTTCAACTTTAAGGCAGCCCATTTTGGCACCCATGGGTACA
ACCCAAACTCGACGAACTCCTTTAGTTCATTCAATAGGCCGGAGCCTATGGACCTCAGCCTCGCCGAGACGGACGAAGAAGCAGAGCTTCGAGCTGTAAA
ACAGCATTGAAGCATTCGACGATGTTTCACGTTTGGAAGCACAAAGCATCTACAACCTAATTGCCCTTTACGCAGGGCACGCCAGGCTACTTCAGGCCGA
ACTCCCGCCGCTACCCAGAAGTCTGGTACGGTGCAGGAAAACGTAGACTCTCAGTAGGCGTGGAGATCCCTGCTGGGGAAGAACTAGGTTCTGTTAAGCT
TCTAGGAGGTAGTAGCGAGCAGAATCGAGCCCCAAGGAGTCCCGTGCACTCTAACACAGGACGTGAATACAAGCCAGGCTTGTTGGTCGCAAAGGCGACT
GTTAAGTGCTGTGTCAAACCCTGGTCGATTTTGATCGACTCCGGAGCATCCGGTAATTATGTCAGACGCTGTTTTCTTAAAGATAATCCACGTTATGGTG
AGGCGCTAAAAGCCCACAAGGATTATACGATCACTGTTTGCTTGGCAACGGTAACTCTAGTCACTGCACCCAAAGTTCCTGTGAACTTGGGTGTGAAGTT
TTTCGATTTTAACAGTATCGAACGCTCTTTAGCCCTTGATTTAGACTCGAGATATAATCTCATTCTTGGTATGGCTTGGCTTGAGCGCCATGAGCCATGG
ATCGACTGGAGGTCGAAACATTAGGCGCCACGCGCACTTCCCCTAGCTGAGCTTTGGAGAGTCATGAATCCACCCCTGCTAGGAATCAGAAGCGTTATTG
GTGCGAGCCACTGGCTGACAATGTCAGTGTGCTGGACATCGGAATGTCAGAGTTAGTTGATTTTGACGATATCAAAGACATGAATATAGAGCAAAGCTCA
ATATGTGATAGTGAAGCGGCACGTACTCCGATTAGTGACAGATGTTGTGAGAGCAACACACTGAATACTGAAAGTATTGTTGACCAAGCGTCAAGTCACC
GAGGGTTTGACCCATCAGACGATCGTGGAGTGGCACGTAAGTACCGACTAAGTGACGTTGGCTGTGATAGCGATGCGCTGAATGTCAATATTGACGTTGT
TGGTGAAATACCAAGGAATACCAAGCCCGGCTCAGCGGATGCACGTGAAATGGCACGTAATCTACGTGATGACAACTTCATGTCAACTGGCTTGTAATCG
GATGTCGATAGCAACATCAGCTCTAGTTTCGAGCAAATTATGTTTAATAATGGTATCGATCAGAGAGATACGAATCACATAGCGTGTTCTGTGGCACAAA
GTAATGATGACTGTCAGCTGTATACACTCTTCAACGGAGTGACTGGTGCCTGTGACGGTACAATTAGCCTTGTGGCTATACCCTCGTTAAGTTCGCTTTT
AGAACTCGAAGAGTTGTCGGTCGATGAGTTTGATCATTCACTAATGAATGGAGACCTTTCAGAGGTGGTAGTCATTCGACCCGACATCATAGAGTTGAAC
CCCTCTTCACTTTTGGGTGAAGCCGTTATGGAAGACACAAAAGCAGCAATCAGTGCACGTAGTGGGTCACCAATATTGAAAAACCCTCATGATCCCTTTT
ATTCCTCAGTCAAGGAATTTCAAGATGTGGTGTGCCACGACCCACCCTCGGTTCTACCTCCAGATAGAGGTGATAGAGGTGTCCGTCATGAAATTGACTT
AGTTCCTCGAACGAAAAAATGTGTCACACGACAGTGGCCCTTGCCTCAGGAGCAATGTGATGTCATTGATGACTTCTTCCGTGCCAAGCACGAGGCAGGA
ATGGTTCGTGAGAGTAAATCTTCATACTCGACACCGATATTTTGTGTCAAAAAGCCGAACGGCAAGCGGAGTATTGTGCGTGCTTATGACAAGCTTACTC
CGGCTACGATTCCGCCCAGACACCCATTCCTCGAAAGGATGTTCTTCAAAACAACATGGTTGGTTGTACTATGTATATTGCACTCGACTTCATCGATGAA
TATTCTTAATTGCTCATGCGAGCGAGTGATATTATGCTGACAGCCGTCAGCACTTCAACTGTTATGCTCTAAGAATGGCTGGTGATGCCTCGAGAGCTGT
CGAATGAGCCGACTACGTTTTATTACTCATAAACCACTTTTTACACCCCCATCGGGATTATGCACAGACGTGATTTGATTATATTTTTGTCCATGGTCGT
GCCGAACAAGGTTGGTCGGATGTTGACAATCACATTGGTCATCTTCGAGCCGTGCTCGAGTGCATGCGCACTAATAAATTTTACGCCAACGCGTCTAAAT
GCATTTTTGATGCAGAGGAGATTCCTTTTCTGGGATGTTTCATTAGTAAGCGCGGCCTTAGAGCGGACACCGCTAAAGTCAAAGCTATAGTGGACTGGTC
GATTCCTAAGAATCAAAAAGACTTGCGTATGTGGCTTGGCCTTGCCAATTACTTACACAAACACAGTGAAATTACGCTGATTTGGCTCGGCCATTAACTG
ATCTCCTTAAGAAGGACACAGATTGGCGCTGGGACAACACCCATGCTGACGAATTTCGGGCAATAAGGGAAAGTCTCCTCCATGCTCCCATTTTGGCGTT
GCCAAATCCTGAGTACCCTTTTAGTGTTGTCTGCGATGCTTCCGATTTTGCTACAGGCATTGCCCTGTTACAAACAGATTTTGCAGGCCGCGAGCGAGTT
ATCGCATTCGAATCCCGACAGCTCAAAGCTGCTGAAAAGAACTATCCAGTTCATTACAAAGAACTACTTGTTATGAAGTATGCGCTCGTCCAATTTAGAT
TCCATCTGCTTGGCTCCAAGCCATTCGTCGTCTACGGATCATGTGACATTACGCACGGCGACACAGTCGCCTCACCTCGCTCAGAGAATGGCTCGGTGTC
TTTCTTTCTTTGCGGAATGTAACTTCGAGGTGAAGTATTAGCCAGGCAAACAAAATGTATTGGCAGATGCCCTATCTCGCAGACCTGATTATGAGCTTGC
TCATGTCACGACTTTGTCGTCGCCTATTGAGGAGTTAATTCGTGTGTCATATCCACGGGATCTTCAGTGTGTGGCATTATTTCATGCCCTTGGAAGTGAG
GAATACAAGGAATTGGACAGTCAATTATCGGCACTCTTTCGGACCAGCCTACATGGATATTCCATCGATAATGGCTTTTTGTGCTATCGCACAGATGTAG
CGAATATCGCTCGCATCGTTGTGCCTCAAAATGAGGGTTTAAAGTGTCGAATCCTCTATACTGCCCTCAGTGGGCATTTGGGCCGGAAAAAGACTTATGG
CTATGTGAGTCAACACTACTGGTGGCCCAAACTCTACAAATGGGTGATTGCATACGTGCTTACATGTGAAACGGTCGAGCGGGTCAAACCCTCAGCACAT
TCGACTGCGCCACTCCCAGTTTACCTGAGGCCACGGGATGTTGGGAGTCCATCAATATGGATTTTTTGTTTGGTACACCCGAAGACTATGACGGCAATAC
GGGAATTGTGGTCTTGATGAACGTTTAAGCAAGATGGATCACTTGGCGGCAGTGCCGGATTCCATCGATGGCAAAGGTACAGCTATCCTGTTTATCGATC
GTGTGTTCGTCAACACGGGTTGCCGCTAGCAATCATCTCTGATCGCGAACCTCGCTTCACCAGCAAATTTTGGACTTCCATCTTCAAGGTGCTTGGCACG
CGATTGGACATGTCCACAGCGGATCATCCGCAGACCGATGGTCAGACTGAGCGAGTTAATCGCGTCATTGGCGACGTTCTTCGGAGTGTTTGTGCTGAGT
CGACTAAGAATTGGAGCTCGATGCTCCCTGTCATTTAGCTTGCGTTGAACGACGCTGTTCATGCCTCGACGGGCTTTACTCCCTTCTATGTGAATAGCCT
CACGCACCCCCGCGTTCCGCTCACGTTACCACTACGTGGTTCTGGGCTTGGTGGGGGAGTCTGCTGGCAAGCTTGCTGAAATCAGCCCTACCACGATGCA
GACACAAGTGAGCGAGTTTCTCGCGACGCGCTTTAGTGCCTTACGGCATGTGCGTAATGCAATGGCTGATTGCCAATACAAACAAAAAGAACAAGCCGAT
TCTAAAGGCAGAGGATGTATTGATTTTTATGAAGCTGGAGACCAGGTCTTATTAAACGCTAAAATCCTACCTACAAATGTAGTGTCTGCCGTCTTCAAGA
CGAAATTGCGTCCGCGCTTCATTGGGCCGTTTACGGTCATAGCGAAGAAAGGCCTTGACTATACACTCAATCTCCCGCACAAGTTGCGCACACACCCAGT
GTTTTACATTGGCTTTCTTAAGCCATATCATGATCCTTA