Description :
From Genome Similarity Track
Location :
Scaffold_17:191635- 198994
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007131Protein of unknown function
Pytul_DAOMBR144PYU1_G007130Similar to rplD: 50S ribosomal protein L4 (Rhodospirillum rubrum (strain ATCC 11170 / NCIB 8255))
Pytul_DAOMBR144PYU1_G007129Similar to ste16: Protein ste16 (Schizosaccharomyces pombe)

Sequence
7359 bases(100 bases per row)
AAGATGGCTGCCATGTTACTGCCACGGAGCAAGGCGAAGGACGAGAAAGCGGCCAAGAGCGCGACGGCCGCAGCCACGATCTGCGACTTGTGCGATGTGT
ACACGCAGAACGGCCTCGAGGGCAAGTGGAGTGAGCTCCTCAAAGTGTACGACGTACGTTCTCCCTGTGACTTTCTTGTTTTTTTCTCTGTATCATCACT
CATCTTCCAAGTTCTCATATGTTTTTTTCCCTCATTGTCGATGAGAGCAGCAACGGCGCAATGATGACAACCTGCGCGAGATCCTGGCGCTGAGTGCGCC
GACAAAGCGTGTAAACGACCTGAACGGATGGCACTTGGAACGCATGGCCGTGGGCGAATACGAAGACGTCCGCAGTGGGTCATCGAACGATGTCGCGCAC
ATTAGACGCGACGTGCGCCACATGAAGCAGCAAGTGAACAAGATCATCGCAAATGGACGCAGCTTCCAAGCGCGACGCGATGCGCTCATGAACGCGATGG
AGAAGCAGCGGCATGCACTCACAGCCGAATTGGACGCTGCCAAAGAGTTTTTAGGGCAGATCCACCTCTCCTCCGCCGCGGCCCCCGAAGCGATTGGGCT
GAGCGCGCCTGCACCTGTGGAGCAGCGCTTACTCGCGACTGTGAAGGCGTCAGAGGTGTCGGCGAACGTCGACCTCAGTGCGGCGCCGTCTATTTAGACG
AGCATTGCGTGCGTTAATATATGGCCACCTTGTTGGTCTCAGAGTAAATGAATGGCGCTATGTTTAACGTCTGTGAAATGAAGCAAATAGGGGATCGACG
ACTACATCGTCAAAGCAAAATCTGCATGATTGTTTGTTTCCTTGTGTCTTCATTTATGCGCTGACTCTCTCGTCTTCCAGTCTTTTCCTCCAGTGGTAAA
CAACCTCCTCTTGTCTCTAATGCGGCCCTGGTGCTGCTGCTGCTTGTTTACTCGACCTGCAGGCGCTCCTCCAAGTACTTGACGGCGTCCTTTGTGATCA
CTAACAAATCCTTTTGCAGGATCGAGTAGACGTTGATCTTGTGCTGCGGAAGCGTGTCAACGTACGGGATGTTGCGCGTCGAGAGCAGAAAGTTGGTCGC
CACTTCCTCGCTGTCGATGAAGAGCGCGTGGTCCCAGCCGCGGGATTCCAAGAACTGCTTCATGTCCTTGGTCTTGGAGCTCTGTGAAGTCCCCAATGGA
TCACGAAATAATGCAATGAGGTTCTGTTAGAGATATTGTTTCTGCGACTGCAAGTATATGCTAAGCATGCACGCACCTCAACGTCCAATGAGTCAACGAC
CGCGAGCTTTCCTTCACGAAGCTTCGTGGAGAGCGCGACGCGGAGACCCATGGCGCGCACCTTCTTTGGCAGCGAGTACGAGAAATCGCGAAGCTTTGGG
CCGTGGACACGGTAACCGCCACGCCATTGAGGGGCTCGGATGTCACCAACACGAGCGCGGCCCGAGCCTTTTTGCTTCCATGGCTTTCTCGTCGAGCCGC
TGACTTCGGTACGGGTCTTGGTCTTGTTCGTACCGGCGCGGCGGCACGCGAGTTGCCATCGCACCACACGCTGGAGGATGTCCACGCGGGTTGGCGCGCC
AAAGACGCTGTTCCACATCAAATCATTTATACACCCTTAGTGGCATGCTATATCCAGCTTGATACAAGTCGTCGTACCTTCCGTTGAGCGTCACAGGCTC
CAATTCCGCGTCCGACTTCAAAGTCAGCAGGTTGATCTTGACATCACCCGATTGCGTGACTTCGACTATAAAGAAACGAACGACAATTCAAAACAGAAGG
GTCAACACCAGCGCGCGCGAGAGTTTCAATTATTGGATCATTCCTATTGTCATTCACCTTTTTGCGCGGTGGGGATCACGCGCGGCGCACGCACTGGTTT
CTCGTCGGCGAACATGAGGTTCGACGGGATCTCCACGGCGGCGGCTTGCGAGCTCATGGCGCGGGCCACAAGGCTCGCGCGCGGCGCGCCGACGCTCATG
GCGGCCACGCCGCTGATCAGACGGTTCAACGCAAACGCCATCCTTCTCTCTGCTTTCCTTCCTTCAGGCACACGCAGCAGCGACGTCGAGGAGCTCCTTT
GGCAGATTTTATGTGCTTTCCAGCCAAGCTAAGCCAGCCACTCGCTGAATGCATAACCCAATCACCCTGTGCCTACAAACAAACACCCAATGACACAATC
ACACAAACAATGGGATATTGAAAATGAATTGAGTCAATTCATTTGGAAAAATGAATTGCGTAAGTGGAGTCAATCCATCTGCAGGGTCAAGTACGAAGTG
GCGAAAAGCGCCGTAAAGCAAGCAAGGAAGGAAGGAGGGCGTCGTGACGTGGCTGCGTGCGTGTGTGCGCAGGGAAAACTCAAGCAGCGCAGGTGAAGCA
GGAGAAGATGGCGCGGAGGATGTCGCTGATGCCCAAGTCTGTGGACTCGAGCAGTCTCGGCGCGATCTGCACGCTCATTGAACGTGGGAACCTGGATCGC
AAATCCAAACTCGAGAGCGCGGGCCGCATCTGCCATGTACGTCTCTAGCGGATATCATAACATGTAGTTTAGCACCGCGCAAGAGAGAGAGGAAAGGAAA
CAAGCCTATTTTGCGGTGCTCTGTGTGTGAGAGAGGCTTCTTGGCGCGCGGAGAACATTGTACGCTGTTTGCTAGGTGAGGCTCTATGGTACTGACATAC
GGGCGTTGTGGGGTCTATGCAGGAGCTGAAAACAGATCCGCTGTTGCTCGACAGCTTCCCGATTGCGAGGTTGATGAAGTGCATGCGGCGTTTGGTTTGT
GACTCGGATTCATCGACGCGGTTGGGAGCGCTCCGCGTGCTGCGATACACGATCTGCAGCAATGAGAGCGTGAAGATCTTTGTGGATCTGGTAAGCCATC
CGTGGCGATATGGCCTTTCAAACACGGATGCCGTCGCGTAGCTAACTTACTTTGTGGTTATATTTTGTATTGCATCCTTCTGACAACAGTGCATTCCGAT
TTTCGTTGTTCGCTCGATGGAGCGCGAGCAAAAGCTTTTGGCGGAGCGTGTACAGGCCTTGAAAGTGATCCGTCGTATCATGGAAATTGATGCGGCACAG
ATGCCACCGAGCCTCGTTGCGTCGATTGTTGCGATCGCTGGACATAAAGATGACAACCTGCGACGCATTTGTTTGGAAACGTTACGAGAACTGTCCCTCG
CGAACGTAGAGGTTGTCGCGGAATGCAACGGCATTAAAGTGATTGTGGACTCGATCCTGGACTCGTCGTTCCAGGATCTAGCAGATTCGTTGATTCTCAC
ATTGTTGATGATTTTGAACGAGCCTGCAACGCGTCAGTTCATTGAGCCGTTCGTGGATACGCAGATCCTGCTTGCGCCATTCACTGATACAGATCTACCA
GCGGGGAACGAAAGACGGCAGCGGTGGATGGCAAGTCGAAACGCGATTGTGACGATGATGCGCTCGTGGACGGTACGGTATTCTTTCTTCTGTGGAAATT
ATGTTTTCGTTTGCATCTAACCATGCCCATGCATTATGTGTGTTTGTGTACTCTATCTGCTCAGGGTATCGTGGTACTGACATCGAACCCGCAAGGTCTG
CAGTCTCTTATCCAGTTGTTGGTTCGACCCGTGGGCGAAGATGTACAAAAGGCAGTGCTCTCGACGATCTGCGAGATTTTCTACAAGAAAACATCCTTTG
ATAAGACTGCCGGCGAAGCTGCGGATGTGGTGTCGGCGACGATTCCCATCAGTGTGTCCTCATCCGACTCGATTCCAGCGCCATCGGGGTACAATCTTCT
CGACAACTACACTGTGATTGTGCTCCTGGCCATGGTGCATTGTGGGCTGTTGGATGCCTTGATCACTCTTGGGACAGGCACGGTTCGATCCCTCGCGGAA
CCTGCAATTGACTTACTCTCCGACATTCTTCGCATGTCGTCTCGGCTTCTCCCAGACCAACATTGCGCGTCGTTGCTTGCACTTCCTCGACTCGTGTCAG
CAACATCGCTCACATCAATGACGACACAAACGCTCGGCGACCAAGTAAAAAGTTTGCTCGAGCGGTTGCAGCGAGAAAAATCTATTCGGGCGAGTGAAAT
GCTAGCAGAGCTCGCCAACGCCGTCGGTGCCAATTCCGGAAGTGTCGCCACCCGTGGTGTGTCGCTCGTATCTTATGGAGGAAGTGGTGTTAATGGTGTG
CAACTCGTGTCCGAGTTGCTTCGTGACATTAACAGACCGTCGACACTGTACTTACAAGTGGGGCGTTCAGGAAGCAATCCATCATCGAATTTGAACTCAA
CGAGACGATTGAGTCCTTACTCGGGGAAAGACAACTTGACGTCCCGTGAGCTTATGGTGCAAGAATTGAAGCACTCGATGGACGCGCAAATGGACGATGC
AACCTTCAAAGATATGCTGCACAATCGATCAAAGATCCTCACCGACAAGAACTTCACAAAGTGGAACTGGGATGTGATCTCGGAAATGCTCGAAGGTCCT
CTTACGAATCCTCATCGGTTGTCCGAAGCGATGAAGACTAAGTTTTTCAAACGTTTGTCGGGTTTCTTCCGCGGCGATACAGGCAACAAAGGGTACTTCT
CACTGCTCGACTGGATTCCAGACAATGTACCATTCCTTCGACCTGCATGCCAGATGTACACGCTGTTGCTGAATCACCCCGAGGGGCTCTTGTTCTTGAA
AACCGATCGGCGTGGTCAACTGTTAACAGAAATCTCGTCGGCGTTGGAACTCGAAGCACGTCCTGAGGCGGCAATTGTAGAATCTCACATTGGTGTTTTG
AAGCAACGCATGTTTTCCCCCGTATTCTGCTCAACGAAGATGTTGCGCGAGTACTTCACATTGCTGGGTTTGATGAGCTCGAGCAAGGAAGGGTTGAAGA
TGATGGAGCAATCAAACTTGTTCAATCGGTTGCACGTGATGGGGACAACGAAAGGTCATGACTTTCTTTGTCGTCTGATCCTCGCCAACTTGGATTATTC
AGTTGATGGAAGCTCTCGTAAATTGCTCCAATCGTGGATGATTGAGGGCTCAAAGGCACTTCGCCTGTACGCCACGTGTCTTCTTCGAGCGCTTTTGCGA
TCTGAAGTGGTGGATTTTGCGAAATGGGGCGTAGATGCGCTGGTTACTCAGCTGACCCAGGAAGAAGAGGTAGCGAAAGCTGCGCTTAGTGTCTTGGAAG
AGGCGACCGAAACCGAAGAGTGTCTTCTAGCGATGATCATGAGACGACCGACGAAGCTTATCCAGATGAAAGATAAACGAGCGGAGTCGTTGTTATTGAA
GTTTTTGTCGCTTCCGGAGGGGCTCGCGTTCTTACAAGGGACTGGTGATTGGATCCCGCGCACACTGATCGCATGGAGACGAGAAAAGTACGTTTCGTAC
GTGCATGCCGTCGAGAACTCGCTGTTCCGTGGTCTGCATCGCGACGTGTCTGGAAGAGAACGAAATACCGTGTCAAGTGCGGGCAGTATGCGACGAACTT
GCTGGCCGACTCCTATTCCAGTTCAGGTGCCGATGAAACGCGGAGGAGTTGTGAAAAACGGGAGCCAGCGATCTCTATGGGGGTTGGATTGGCTTTACAA
AATGCCCTGGAATATGGAAGTGAAGATCGTTGGGCCTCCTGGCAGCGGACCGCCATCCAACCTGACTGTGGAAACCTACATTGACGGCTCACTCCGGGAC
GAAGAAGACAGTGCCTTGGACGAAGACGACCTACGAATGAATTCCATCCGAGTGAAAGCAATCGTTGTCGACGCTCGCAACATGCCCCAACCTGTGATTG
TAAACTCCCAACAAACACTTCAAGCATGCCTATTCTTGGGAACGCAACCAATTGATCGTCGTGGCTTCACAAAGCCTCCGCCGAAAAGCAATGGAGGTTT
TGTGATGCCTCCTTCGGTCATGGGAACGGACGCTCAAGCTAAAGGACGATCACGCTCGGCGTCGGCTGCAGGCGGAGATCGCTCGTCGGAAACGAATGCT
GGTGTTTTTGCTGATCCAAACTATCCTGCTTCCGAGTCTGCTGCAGAAGAACACAAGGATTGGAGTACTTGCCAACCAGATCAGCGCTCTCCGCAATATT
TGACATCGCCTGAGTGCTCGGTATGTGCTCCAGGGGAACGAGCAGTCTGGAATTTTCGCGTGGAAATGGACAACAGCACCGGCAATGTGAAACGTGTCAT
GCTCAAGTCCGTTGAATTTACGTTGCAGCTCTTGCCACTGCGTCCTCGCTCCGTTCCACTGCCACCCCACCTCTACGGCGAGCTCGGAAAGACAAGTGCA
GGCTGTCAAATCCTTCACAACTCAGGACACATCCCCGAGTTTATTGCCTGTCTGCGAGATAGCGCGAGTGTCCCTCTTGAAAAGCGAGCAGCTCTTTGGG
CACTGGGACATATCGCTGCCACGTCTAGAGGGTACGATTTGATTCAGCACTACGCCCACGATGTGCTCGACATGATTGTGAAGTTGACCACGGACTCGCC
GCTGGTGTCGATTCGTGGCACATGCTTCTTCGTTCTTGGGCTGATCTCGCGCTCGGCACCCGGGCGTCGCGATTTGTCGCAATTGGGATGGGATGCAGCA
AACGTCTCGCAGTCGTCGATTTCGGTGCCTCAAAACTCAAACTCGCTTTTCGTGTGGCCTCGTCCATCAAGTAACGAAGTTGCGAACAAGACTTGCCCTG
TCACGCAAATCCCTACGTCGCCATTGCAAGCCCTTCTCTCGAAAGTGCCGCCAGAGTGGAGAGAGCTGTTGCGTCTCGTTGCTGATCTGAGTAACCATAT
TACACAGAAAGAGGCACATTCATCGCTGAACAAGCTTCGTGCGTCCAAGTCGGAGTTGTTTGAGGAACCAATGTTGCTGCTTTACGTGCATGCACTCTTG
GAGCGGTACAGCTACCGACTCGCGTTACGGCAATTTGTGCTCAATGCCTTTGATCGCGCCGTTTTGACGGATGAAGTTCTGGAGTCGATCAGCGACGGGT
ACAAGACGAGCACAGGGATGCGCGTCCCACATCCGCGCGAACTCTTGCGGCGTCGCTCATCTCCGTCAATCCCAGCGTTCACGGCTTCGATTCAAAGTTT
GAACTCTGCGATCCAGAATACTGGTCGTATGTCGTCGACGAATGGAATGAGCATGGGTGGTCCGCCGTCGTTCATGGCCAGGGCGTCGACTGGGCTCGGT
CTCACTGGTGATGGACGCTCGACATTCCGAATGAACAATCACGAGCCTATCGACCGCGCCGTGCTGCTCAAGCGAAACAGAAAGCGTGTGGCTCACTCAG
AGAAAACGATCGTCGTTGGCGCGCCGGAAGCAGTTGTGTAAAGATGGAGTCAAGCTTGG