Description :
From Genome Similarity Track
Location :
Scaffold_75:19155- 25612
Transcript NameFunction/comments
Physo_139506reverse transcriptase

Sequence
6457 bases(100 bases per row)
AGGATGCGTTCTCAGGATTCGTCATGTGTAAACCCATGAGTTCCACCACGGCGCAAGATGTCGCTGAAGTGTACGAAGAGCAGGTCTTCAGGAGATTCGG
CGCGAGCTCGATGCTGAGGCACGACCAAGACCCAAGGTTCATGAGTGAGGTGTTCACGCGTTTCCGTGAACTTTTGGGTAGCAAGCAGCGAGCCACTCTG
GCGTATCGCCCCCAGGCGAACGGACAACAGGAGCGGTCGGTGCAGACTGTCGTGCGCAGCATTCGAGCGTACATTGCTGAGGCGGACCAGAGTGACTGGG
ACGACCATGCTGAGCGCCTGATGTTTGCCCTGAATACATCGTTCGATGCCACTCGCCTGGTCACTCCGTTTTTTCTGGTGCACGGCTGGGACGCACACGG
CACGGTGTCTGCAATGTTAGGACCCAGGCCCTCGAGTATCCAGGAGCGCACTGCGTACGAGTGGCGCAGGAAGCTACAGCGTGACTATAGTTATGCACAA
GTTTGCGCTGAGGATCTTCAGAAGAAGGCCAAGCGCGCGCGCTCTGCCGAACAAACCAGGAAGTGGAGAGAGCTGTCCGAACGACTGAAGGCAGGATTCG
CAGCCGGTGATGCTGTGTGGCTGTATATACCCAAAGTGCAGCCCGGGCTGAGCCGCAAACTGGTTCACATGTGGCATGGCCCCTTCAGAATTCAGGAAAT
CCATGACAACTTCCGCGTGAAACTCAGGGTCGAGAAGACAGGATATCGCGTGAATCCCTGGGTACACGTGAGCCGTTTGAAACCCAGAGCACTATTTCTG
AAGCGGCCCACAGTGGAGATCGACGTGGACGAGGATGATGACTTTGATGCGGCGCTGTTGCCTGAACACAGTTGGGAGCCCGACGCTGCGAACGATGAGT
ACGAAGTTGAGCGAATCCTGGATTTGCGATGGACTAAACGGACTCGGACAGCGAGACGAATTCGTGAGTACCTTGTGAAGTGGAAGGGGTATGATGAGAC
CGAGTGGCTGCCTGTGTCGGAGCTCAACTGTGGTGCCCTACTCTACGAATTCAATCAAGGCGCAAGAGCGCGGGCCCGTTTCCAGGCCAGGCAGGCTGGA
GATGATCACCCAGGAGTCTAGCACTCTGGGGTGACAATGACCCAGAGTTACACGTGATATTCAGGGGAAACTCTGGGTGACACTGTGAAACTCTGGGGAA
AATCGACGGAATGCGTGAATATTGGAGACGGAAAACGTGAATGTGATTTGACTTGATTTGATTATGGAGAAGGAGACGCGCTCGGTCACGCCCGTCTTGG
TGCTGCCCGTCGAAGTGTCGCCGGACGCTGGTGCGGTGCTCGCAGGGGCGTCGCCGGTGCGCTGCTGTGTCGGAGGTGGCGCGCTGCCGGGGGGCCGTCG
CTTGCTTGCCGTCCGAAGTCGCGCTCTCCGCCATGTTGACGATCTGCGAAATGGCGATGTGACTGCGCATTGCCCGTTGGAATTTCTGCGTTTGAGAGGA
GAACCTTGAAGATAGGTCCTGACCAACCGTTCGGGAGACAGGGTGCCGCCAAAGTGAGTGAAACCCTGGGAGTCGACAGAGTGCAACGGCCGTATCGAAG
TCGACGGTGGATGGACCTGTGCGTTTTTGTGGCCTGGCCATGGTTCACCAGTTCGGAGCGATTTCCTCTTTGATGGACCCGGACGAGGAGGGGCGGTTGA
CACGAGGCGGTCCCCAGAAAATTGCCGACGATGTGCCGTCACCTCTGTGACCTGGAGTTTGTATCGGATGCTGATTGGTGGATGACTTGGATACGGCGCG
GCTGTACCCGTGTGACATGGATGGCGACTGTGGGAGAGAAGTGATTTCTCGCGATATATCCAGCGTCTGACCGTAGATGGGTCCAACTGGCTGGAAGTTT
GAATCCTGGGAGTGCACGCCCAGAATTTCAAGAGAACACTCAGTCCAGCCGCGGACTTCCCTTACGATGAGTGCCTAAAGTCTGGCGGAAAGTGTCTCTG
GAGAATGTATCCCAGAGTACACCTCATCTTGCTGTGGCTCAGAGTGCCCCAGAGGATCAAATTACCCTGAGAATCAACCCACTACTACCATGATCATGCG
CAGGAGGCCGCTAAACCCACTAAAAGTGTGGCTTCGAGGAGATACACACGAGTCTGCACCGCAGCAGACTTGTTACCTAGAGTGCCGCACGGAAACCTAG
AGTGCCGCACGATGACCCAGAGTTCACCTCCCTGAGTGCAGGTGACCCAGAGTTCCAAAGATGATTCTCTGGGTTTGGACCATAAATCCAGACTCTCTAT
ACTGAACTTAAGTGTTTCCCGAGCCAACACCCAAGAATCCCCACAGTTCCCCAAGATTCCTCAGAATTCCCAGGATTTCAGAAGATGACCCTGAGTGTCA
CCTGATTTTCAGGGATTCGAGTCAGTTCGCAGTCAGTCTGCAATCAAAGTGATGCGTGACCTTGAAGAACCGTTGTGGATGCGCAGACTGGATACTTTCG
AGGAGTCGAGAGGGAGTCCTGCACCATACTAAACCAAGTCTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATTT
CGCGACACAACTTGCCTAAGTCGGACCGTGGGAACACGTTCCTGCTGCTTTTTCAGGATGCGTTCTCAGGATTCGTCATGTGTAAACCCATGAGTTCCAC
CACGGCGCGAGATGTCGCTGAAGTGTACGAAGGGCAGGTCTTCAGGAGATTCGGCGCGAGATGTCGCTGAAGTGTACGAAGAGCAGGTCTTCAGGAGATT
CGGCGCGAGCTCGATGCTGAGGCACGACCAAGACCCAAGGTTCATGAGTGAGGTGTTCACGCGCTTCCGTGAACTTTTGGGTAGCAAGCAGCGAGCCACT
CTGGCGTATCGCCCCCAGGCGAACGGACAACAGGAGCGGTCGGTGCAGACTGTCGTGCGCAGCATTCGAGCGTACATTGCTGAGGCGGACCAGAGTGACT
GGGACGACCATGCTGAGCGCCTGATGTTTGCCCTGAATACATCGTTCGATGCCACTCGCCTGGTCACTCCGTTTTTTCTGGTGCACGGCTGGGACGCACA
CGGCACGGTGTCTGCAATGTTAGGACCCAGGCCCTCGAGTATCCAGGAGCGCACTGCGTACGAGTGGCGCAGGAAGCTACAGCGTGACTATAGTTATGCA
CAAGTTTGCGCTGAGGATCTTCAGAAGAAGGCCAAGCGCGCGCGCTCTGCCGAACAAACCAGGAAGTGGAGAGAGCTGTCCGAACGACTGAAGGCAGGAT
TCGCAGCCGGTGATGCTGTGTGGCTGTATATACCCAAAGTGCAGCCCGGGCTGAGCCGCAAACTGGTTCACATGTGGCATGGCCCCTTCAGAATTCAGGA
AATCCATGACAACTTCCGCGTGAAACTCAGGGTCGAGAAGACAGGATATCGCGTGAATCCCTGGGTACACGTGAGCCGTTTGAAACCCAGAGCACTATTT
CTGAAGCGGCCCACAGTGGAGATCGACGTGGACGAGGATGATGACTTTGATGCGGCGCTGTTGCCTGAACACAGTTGGGAGCCCGACGCTGCGAACGATG
AGTACGAAGTTGAGCGAATCCTGGATTTGCGATGGACTAAACGGACTCGGACAGCGAGAAGAATTCGTGAGTACCTTGTGAGGGGATCCTCAGAGTCGAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTCGTACGCAAGTTACCTTGGAGCTGCCTACCAGAAGAGAGATGCATGG
GGGACCACGGGACTAACGCTGACATCCACGATGCGGGTTACCATGGGGCGGCTCACCAGAAGAAAGATGCCTGGCGGGACCATGGGACTGATGCTGAAAT
CCTGGATGTGCGTTACCATGGAGTTGCTCACAGGAAGATGTTGCCCTGGGGACCATGGGACGAACGCTGGGAGTCGTGGACGGAAGATGGGTACAAGCTC
TCACCACCCTGAAGTTGTTGAAGAATTTGAAGACTGTTGAAGAAAATCCTGGGAAGTGACCTGTTGAGGTCGGCCTGTTGAGGTCTAATAATTGGTATTC
TGGCCTGTTGAGGCCTAGTCTGTTGAGATTAATAAAGAGTTTCGTTTACCCTGTACTGCGCAAGTGACTTGGGCCAAGCCTGCCGACGGAAATCCGGAGG
ACCCGAGACTACGACCGCGGGACGCTAAGGGCACATCAACGGCGAAGGACAGCCGTCTGTGTGGGCTCCATCAAACTCAAGTCCAGTTAGGTGGTGACCA
GCGACGGCCTTGAGCTTCCTGGGGTGATCCATCTATTCCATATCCTAGTTGGGTCACTTGCTGTGCTCGTGGTAGCCCATTTCATATTATTCCAGAGGGT
ATTCTGGGGTGCTAGGTAGTCGCCTCCAGGATTTTGTATTGACTGCTTGTGTGAAGGGAAGGTAACTGATAGTGATAGTATTTTCCTCCTTTATTGGAGG
TGGTGCGCGTTTGTGTGAGTCTCAGGGGAGCTAGGCCCCTGAATTTCAGACTCGAGTGAGCCTAGTGTGTGTGTGACCCACCGTCCAAGGGTCCAAAAGA
ATAAGTGACAGCTAGTTGTAGTGTTTGTATACTCTGTATTTGTTGGTTTTATCGAGCTAGGAGGGCATTTGGGTAAGGTGTCTTCTGAGTTCCAAGTCCC
AGAGTTGACTGAAATCCTGGACCCTGAATTCGTGATATTCTGGGTTTCAGGGGATCTGATTCTCTGGGTTTGCCTTTTGGTGTGGAGGTGCGTTCTGAAG
TAGACGTGCGCTCCCGCACTTCTTCGAGGCTACATTTTCAACCGGTGGAGTGCCGTTCCGTCGAAGACAAACGAGCCGACAGGGATTACAAAAGGTACCC
ACGCCAACCAAGGAGTGTGATTCTCAGGGTTTAAAGCTTTGCGGCTGCGAATCTCTGGGTCTATCTTCTTGCTGTTGACTCTCAAGTCGATTCTCTGGGT
CTACCCCTGGGGAACAGTCTTGGGCTGCGCTATACGAACCCCCCTGGGCGACAAAGGTTTCATCGGCCTCGCCTCACATCAATGGCTGCTGGCGCCGATT
GTCGTTGAAGACGACAACTGCATTCTACGCAGACATGATTACGTGAATTCGTTAGCCATGTTACATGTAGGCCCAAACTGACAAGGCAGGTTCACCTGTG
GAAGCTCGCGTTGGTTGTCTTCATTATCCTGTTTGCCAATGAGTCAGCTGTCAGCCAACAGGGAACCCAATGGATCTGCAGTAGGCAACACCACCGTGTC
GACTACAGTGAGCGACAACATACTTGGATCCGACTGTGATCTGACTGAAACATCTGAAGCCTTCGACTCAAAACTGCAGCACACAACCAGCTGATCGCTC
TGTCGAAGCGCAGCAGCCGAAAAGCTCTCAAGAAGTCCCAGCGGAGAGCCGCGATTGGAACTGTTGAACTGGTGGGTTGGGTATGTTGGTTTGTAGCTTG
TGGTTGAGGGGGCAAATTCCGAAGTGAGATTAAATGTTATCGTCTCTCAAACTACTATCTAGTCTTTCCCTCCTGCTTTCCTTCTTGTTCTCCTTGTGCT
CGTTGGTGCCTCTCATCAGACGGATTACTCCCGGGTTCCGATTGACTTGATCTCAGTATACTTGGGTCTCCCTGACCAGCCATTGGTATATCCAGAGCCC
GGCTGCCGCCGGCTCTCCCGTCGCCGTCGGATCCTCCGAGTCATCGGCAGATGTGTCCACACGTTCTCCTCGTCCGTGTGCATCGATTGGCGGCGCTCCC
GAAGACTCATGAACAGGGCAACAGTGAGGGAAGCAACGCAGCAACTAAATTGCACGGGATATATCCAAAATGAGGAAGTAACAGACAATGGTACACCGCG
CGCTGTAATCGGCTAGCAGACAGTAACAACGTGGCTAGTGTCAGTAGACATGCCTCGACTCCTCCCTGTTCCAGGCTGATGCACAGTACAGTTCTTCAGT
AGCTCGGTCCAGGAGCAAACATAACCTGGTAAGTCACATCGTCCTTCTTCTGCCTGGGGTATTCCTGCGACGCGCGACTTGTAACAGAACCCTAGTTTTT
TTGGGTATCTTACGGGATTTTTAAGGATCCAAAATTAGCAAAATATGTAATAAACCGAAATCAAGTGTCATTGTAAAGATAAAACTGTTGCGTCCGTCGG
CATCCACATCAAGCATGCCACCTCGAGCCACGGGAGGCTCTCAATCGACTGTTCCTCCACGCAAGTGGAAGAAGCGGGCGGATCGTAATGAGGCGGCCTA
CAACCGCGCTGTTGAGCTCCTTGGTGAGGAGAAGGTTCAGGAAATTCGACGCGAGTGGGATTCTTGGGAAACGGAGTTTGGAGGGCGAGAATGGGAGCAG
TCAGAGGGAGTAATTCTGCAACTCATCCAACAAGGATTGTCAGAGCGAGTTATTCGT