Description :
From Genome Similarity Track
Location :
Scaffold_180:19152- 22631
Transcript NameFunction/comments
Phyag_g3152hypothetical protein

Sequence
3479 bases(100 bases per row)
GTGTTCTTGCACATCCACCCAGATCTCTTTCAGTCGGCCCCCTTTGTAGTTGTCAAAGGTATCTGGGGGTTCGTGGTCGTGTTCAGAACAGTCCTTTGCA
GTCAAAGCTTCGAGCTCGTAAATAACAGAAGACAGACATGCGCGTTTGTTAGGGTCTTGACAGCACATCCGCCGCACTAGTTTGCGAGCATCGCCAGAAG
GACAAAAAgggtctcctccaccatACGCATCCGTCTCAGGAGTCCACGTCGTCTTGGAAAGTTTCACCCAATGTTCACGTTCGGTATTCCATGGCTTCTC
GCTCGTCACTGCTTCCAAAATGCACATTCCCAGAGAATATACATCGGAAGCAACCGATGGCGGGTTACCTACCATAACTTCAGGAAACAGCCAGCGCATT
GGTCCAACAACACATGAGGAATCACGACTGCACTCTGTCCTCGTGACACTCACACCCAAATTCGACAGCTTCGCCAAGCCACCACTGCCAATAAAAATAT
TACAGCACCGCAGGTCTTCGCGAATAGTCCCCCGCTCGTGGAGGAATTCCAGACCCAACGCTGCTTCATACAAATATTTCCAAATCTTTGGCTTTCCGTG
TGAAGTTAATCTGACATGCTCAAGAAGTGAACCTTTGCTGGGGAGCTCGCAAACAAAGAATCGCAGACTCGGACCAACATCACACGCGCCGTACATTTTG
ATGACATTGGGATGCCGCAACTTCTGCCATAAACGAACTTCCTCGTCAAACGACGATTGGGACGCATCAGGTATGTACAGCTTCACGACAGCATCAGCGT
CTAACCATTTAGCAAGGTATTCACCCCCGATATTGCGAGTTTGGCAGAATTGTACCAACTCAATATCAGATGGAGGGATGATCCATGTTGGTGCTCGATC
GGAAGACTGAACAACGGAGTTAGCTTCGCCAGCGCATTGTTTACTTAAAACCGGTAAAACAAATTTTGTGAGCACCCGCTGAATCTCTTGAAATCCAcga
tcagcagcaattcGAAGTGCTGTTTGGCCTAGGCTGTTTCGAGCATTTACATTAGCGCCGGGTAGTTCAGCAAGGTATTAGGCCACCTCAATGTTGCCCA
TACTAGTAGCTTCCATCAGCGCCGTGTGTCCGTTTTCATCACTATCGTTCACGTCAGCACTCCGTTCTTTAGCGAGATACCGAATGATGTCAAGGTGCCT
CTTTTTGACAGCCTCGAGAACCAGTTCTGTTCTGGTGTTGCTCCTGATATTGGCATCCGCTCCGTGTTCAAAAAGATAACGAGTCACCGTGAAATGGCCT
CTTTCGATAGCTTTCTGCAGTGCAATTTTCATCACGTTCCTCCATTGGCTCTCCATCATCGTGCTTATGGGATTCAAGCCTGTGCCGTGTCGTTCGGCAA
GATAGTGAGCGATTTCAGTGTGTCCGTTCTCATTGGCTTTCGTTAGGGCTATGTAATTCACGGTTACACCAAGCTCTTCAGTGAGATACTGAACGACTTC
AATATCTCCGTTTTCAGCGGCTTTTACCAGCAATAAAAAAAATTGACGGCAGCGTCTATAGTACCGCGCGCAATGCTGCTCAACGAGTAACTTAACGATT
TTAATGTCCCCATTTTCTGCGGCCTCTACCAATTCTGCTTGTTCTCCAGCAATAATTTCCGTGCCGTATATGTCGTCAAGGTAACGGGCAATTTTAATAC
GTTCACTTCCTATAgccttcatcgctgctgtcatttCATAATGATCACTGATACTTACATCCACGCCACGTTCTTCAACGAAGTATCGGACGATTTCAAA
GTGCCCCTTGATAGCAGCCCACATTAGTGCTGTGACTCCGTATTGACCCTTGACGTTCGCATCTACTCCACGTTCTTCAACGAGATATCGGACGATTTCA
AAATCCTCTCCGACAACAGGCCACATTAGCGGTGCGTGCAGGTACTGGTCATTGATGATCACATCTACACCGCGTTCTTCAGCGATATTCAGGTCGAGTT
CGACATAACGTACCAGCTCCAAGTTGCCCACGCTAGCAACCAGAGGTTCTACAGAGCGATGTCCGCTTCGCTTTGGCTTCAGTCCAAATAACCAGCGCAG
CAAAGAGCGCATAAGCTCTTTCCGTCGGAGGACGCTCTGTCGACTGACGACTGGGGTCTCGGATTCAGTTTGACTGGTCAGCTGTCTGAAATAGTGCGGA
GTGAGGTCTGAAGCTGGCTCGGGAATGAGGAACTACGAGAGACCGAAATTCTGCTTGTAGGATGGTGGGCATGTCTTGGCTATCGCGTCGTGATAAAACT
AAAGGTAATCCCACAGGTTATTCCACTTCTGTTTCATTGTAGGTCAATTTCCACCCTTGCAGCAGACGTCGGCTCCCAGACACACATATACTATACAAAG
TAACTCGATCGTATTGCTAATGCCGCCGTAGTGAACCCCCTCCTCATGCAGAATCAACATTTCATTCACCCGCTGCACTACATTCACCCGATTGAATCGT
GATCAACACCCGAACTCTGCTTTTACAACACCAGGAGCTGATTTTCGGCTGATGCCGGATTGACTACAGGCTTCTCAGGCTTCTTTTGCATACTGGCTCG
TCGATTTACCACAGCTCCATATCGGTGCGACCAGATCGCGTCACAGTCCAACAACTCGAGGTTGATACGTGTTCACATAATGTGGACCGCCATTTCAATT
GTTATCAAAGCTCCTGGAGATGCAGCTTGCAAAACCACTCCATTTCCTCCTTCACAGACAGTCTTTCCAGCATCGCGGCAGCACTCAAACACTCTCCTGG
TCTCTCCAGCCATTGGGCCACTACATtacacagcaccagcagagaAAGCAGCACCATAGCTGTtcggcttcaacatgtacTTGGGCGGCATTCGCCGCCT
AAATGGTGGCAGTGCAAACGCAGTAAACCACAACGCGTCCTGCCTTCTCAATAATCGTCCAAGTGCATGTCGTACCGACGCAACCGTAACATTCGGTCGT
ATCCTCTCTCCTTCACGCTGCATAAACTCAATCGTACTCTGCTCCGTGAGCACCAAATACGCGTGCCATCCCCAATAGCAGCAAATCACCACTCCAACCA
CACTCGTCGCCATGAATGAAAATAACACCTTGAATCGATCCATCACAACTCTCTGTCGCTCTGAAGCCTCGTTATCTGCACTGCTGGTCGTGAGCGTCTC
AATAAACTTTCCAGCCGACAACATCGCCACGTACAAACAGCTCACCCAGAtgtacagcaacaacagccaAAAATGCCCTACATATACGCACAAAATACAA
CTTAGTTCTCTCAAATTTAATAACGGGCTCATAACCTCCTTATCAACGTACGATAGTTGTAGTACCCGACACAGTTGTTGATCCAGGGACAGTGGTGGTC
CATTTCGTAGACACATCGTCGACACTCCCTACAGTGATGCGCCTTATGAGGCTTCACCCGATTGCAGGGCTCGCATATT