Description :
From Genome Similarity Track
Location :
Scaffold_311:1915- 3228
Transcript NameFunction/comments
Phymu_g8422hypothetical protein PHYSODRAFT_337222
Phymu_g8423ATP-dependent RNA helicase, putative

Sequence
1313 bases(100 bases per row)
AAGAATAAAGTCCCAGTGCTCTTGTACTTGTCGGTGCCCCATAAGGCCATGGGACTCTGGAAAAATAACGTATCTGCATCGAGAAGCATCACTTCTTGGA
ATCTCGAGTAAATTACCGCCAGTACTttgatgtcgaagctgcggaaTTTATGGTGACAGTGTTCCAGATCCACACAGAAGAGTTTACGGCCGTCTAGTGC
TGCACTGGCAGCTAATTCACAGACGTCGTAGAACCGGATCGAGTGGAGCTGGTCCTGCATCTTGATCTGGAGTTTTAGATCTAAATCTCCGCAATGTGGA
ACTTCCACCGGTAAATTCACTTGGAGACGCCCCAGTTCCAATAGAAGAGAGAAACCCAGCAGCGCAATGTCGTCGAATAACGGCAGCACAATGCCACGCG
GAGTTTTAGCGTTAAAACGTTGTGTCTCGCGAAATAAACGGGAGGTGAAGGCTTGGATTTCGGATCGGGGCAACGGGGATACCGGTACGCTCCAGAactg
gcgacgacgagaagccAGCAGCGATTGAGACAGTTTTAACgtcaaaaagaagaagaggaacacCGATagcaccagcagaagcaggcgaTTACGACgtgac
agcagccacagatGCACACGCGTCCGGTAGCGGCGCCAGTGGCGCTTCCGCTGGGCGTCATAATGATCCCCAAGCATGGTAAAATAATAATTGTGCAATT
ACCGGTAGGGTCGGTACAAACGGTAAGTAATTCGAGTCGTACTTAGTCGAACACTTTTTTATGACGGTCAGATTTtgtcttcttttttttcttcttacct
cttcttctcctgttgaATTGCTGCCTTGACTAGAGTCCCCCACGCCCGAGTAAAAGCCGTTTGATGACTGTCCTTGATCCAGCCCTGCAGCTCTGCCTTG
AGGAAAAATTTCCCGTCGGATTGGCTCCATTTAGCAACAAGCGCTTGACGGGAAGCCACTCGACTCTGTTGCAGCTTAGcgaccagcaactggatcttct
tgtcgaacttcttgcgGATCAGCGTGTGGCTGGGCTCCTTCAGTGCGTTCGAGAACGGTAAAAGACCGGTAATGACCTGTCCATCCAGCAAGAACTTGGC
AAACCACCGGTACTTGCCCCCCAGTCCGTCCTTCGAGTCCTGTGCGTCTTGCTCCGGGTACACGATGCGCATCGCCGGTAGAGCCCACTGGTGGACGCCA
TACTGAGCCTTAGCATAGCACtgcacgtcgtccagctctgcaTCGTAGAACGGCGCAGGTTCGGCCAGTGGCGGCGCGTATTTGCACAACGGCGTGCTCT
TCCCGATACCGGC