Description :
From Genome Similarity Track
Location :
Scaffold_60:191461- 197745
Transcript NameFunction/comments
Physo_138097hypothetical protein
Physo_138098reverse transcriptase

Sequence
6284 bases(100 bases per row)
TCAGCTGTGTCCGAACTGAAGGACTTCAGCGGCAAGGAACATGACGAAGAAGCCGCCCGAGCCTGGTTCAACGAGGTTAGAACGGCTTCCCGACGGGATC
AGATGCAGCCAGACGAGATGTGCTTGACATTTGCCGATTTGATGATAGGCCCTGCGCGCAATTGGTATTACCAGCTGAGCCGCACCGCTCGCGCGTCGTG
GACTGACCTGGGTGAACAGTTCCAGATCCCCTTTTGCGGTAAAGGGATCTCCCTCGCGCGCAAGTACTACCACATGCGGCGCGGGAGTCAGGAAGACCCA
CCAGATTGTTTATACCGGCTGAATCTGGCCGGGATACGTGCAAACTTGAAGATCCATGATGGCACCAAGGAACAACGACGTGAACACGTCGACCACTACA
TCGATACAGTCCAAGATGACGATCTCGCCGGATCTCTGGTAGTGTTGAGGCTGACTGACTCAGAAGCTCTCGAAGGCGTCCTGTTGGCCATGCGACGCCG
CCACCAACGTCGCAAGATTGAGACACAAGGTTCGAAATACCGCCAAAAGGCTCCCGCCCCTGCAGCCTCCTCGAAGGCGGTGCGGGTTGTGACTACCGGT
CGCGGACGCCGCGGAGATCACGGAGATCTCAACGAGTTCGAGGGCGAATCAAGCAGTTCCGATAGCGAATCTGAAGACGAAAGAGCGCACGTATTTTTGG
CAGCTAGGACGCCTACACCAGGAGATGGTGAACAGCCAGGGGCGCGCCAAGACCGCGAAGACCAACTGGGGCGTCCGAAGTACGGCACTCGATGCTCACA
CTGCGAATCTCGCAAGCATACGGATCTCGGGTGCTGGACGAGGCTCACGTGCCAGAAGTGTGGACGCATGGGCCATCCTACCGACAAGTGCTTCTACGTC
TGCAAGTGCTGTGGAGACGTTCACGAAGCAGGTCAGTGTAAAATCGGCGACTTCTTCGATGCTGTTCGCCAATGGTACAACCCGACTCGCCATGCCGGAC
TGCTGCCCGAGAGCGTCGAGAAGGCGTTAAACTAGACCGCTCGCCAGGCCTGAACAGCCTGGCACGTGACGAGCGATCGAAGTTCTGCATTTATGCATAT
GTTCAGAGGAAGGCGCGAGCGTTAGAAGACCCAACTTCCTGTAATGCGGTGAATACAGCCAGATCTCTTACCTCGGACGAAGATGACTATTCGCGTCGCC
CTTGTGTGATGGCCCTTCGACTGCCGCCGGGTGAACGCCGAGGTTACTGGAAGTATTACACTCCCTCCAAGTGGTTCAAGCAGTCGAAGGCGACCGGTGC
GGTCAACAATGTCCGTGCCGTCCTACGCTTTGATACTGGAGCCATAGTGTCGATAATCGACTCTAGCTTTGCACGTAAGGTGGGTTGTGAAATTGATACA
ACACAGACAATGGATTGTGTTGGTGTGGGGGATGCTGTGTACTGCACAGAAGGCCGAGCAGAAGTCATGCTCACTCTGGCTGGAGAGTTGGTGGCATGGA
TTTTATGGTTCCTGCGGGGGTGAGGTTGGACCTGGCTGACGGAACGCTCTGTCTGCCGGACGAAGTTCGCATCCAGATGACCGACCGTAAGCCACTGTAT
AGCAGCAAGGCTGACGCGGTCTACGCAACGGGATTCCATGAAGTCGGTCCTGGCCAATGGACAGAGATCTCACTCAAGTCCCACAACAAGCGGTTTGAAC
TGTGAGTAACGAGAGGGGGAAAATGGGTGATCACGGTGGTGAATGGTGGATTCAGTAACAAGTCATACCTCCGGATCACCAACATCAGCACGAGCCGCCT
GGTACTGGATCGTTTGGTGTGTTTGGCAATCTGGTTACCCGTTGGGCAGATCCCGCGTCGACCTGGATTCGCTAGGAAGGATTCAAACCGCTATCGGGAG
TGGCAAAGACTTGCGTTCAAAGCAGCTGTGGACACTGGAGATGCAAACGAAGCGGAAGTTGAAGAGTCTGGACCGCTGGTCGAGCGTCCTAGCTACCGGA
CTACGACTGCGATTTTAGCACGGCCTCCACAAGTGAAGACCGTTGTAGCAGCAGCAACGTCAGAAGAATGCACGCGACTCACACTGGACGGCACACATCC
TCAAATGCAGCTGATGAAAAGTTCGACTGATCCGACTAGGGTGACCGAAACCGAGGAGGACGTGATCTCTACCGATCCCGGTCAGGTGATCTCTGGTATG
GACAGCGATGACTCCTGTGCGTCCGAAAGCGCTGAGCCTACTGGTAGCTGGGGTAGTTTTGACTGGCAGACCGACGACGAGAAAGAAGAGGAGCCGGTGA
GCGGAATGCTCCCAGTGACCAAGGCGAACCAAGCCAAGGCGGAGATGCAACCGACATGGATGAAGCGAAGTATGTTCATGAAGGGGCCGATCTCACTGCG
GAAGACATCGAAAAGGAGATGGCGGTGTTACCAGAGATCTCCCTGACGGCAGAAGTTAAAAGGGAAGATCTCAAGGTCGGGGATCCAACTGAGAACACAG
CAGAGGAGATTGATCGTCTGCGTGATATCATTTGGGAGCGGCGTCACCTTCTCATCGGCAAAGCGAATGCTTTACCCCCTGCGGCGACGGGGGCGATCTG
TGACATCGACGTTGGTCGATGGCTCAGCGTTGTCGCCGGATCCCGCCTCAGTTCCGTGAAGAGGTGTTCCAACTCGTCAAGGGGCTACTGGGGGCGAAGA
TTATTCGGATCTCCACTTCTCCTTGGGCGTCTCCGATCGTTATCGTCGTCAAGAAGAACGGCGTGGACGTCCGACTCTGTATCGACTACCGTCTGGTCGA
TGCTCTGACACGACTGATGATCTACCCCATGCCGTTGATTGACGACCTCCTCGAAGATCTCGACAGTTTGCTGTGGTTCTGTTCTCTCGACATGGCGAGT
GGGTTCTGGGTGGTGAATATGACCGATCGAGCCCGAGAGATCTCCGCGTTCATTACGCTGTTCGGCCTGTTCGAGTGGCTGCGAATGCCGTTTGGTCTGA
AGAATGCCCCCCAAATCTATCTGCGGCTGATCGACAATGCGTTATATGGCGTGCTGCGGATCTCGCCGGGCCAAGATCGCGCGGATCTCGTCAACATTTT
CGAGGAAGGTATTCCTGAAGATCGATCGCTGCCGTCGGTGCTGGGGCGTCGCTCTTACATCGACGACATCTTAGTTGGAGCAAGCTCGTGGGACGAACTA
TGTGAGAAGGTCAAGAAGCTCCTAGAGGTTTGTGACCGCTGGAATCTGTCTATTAGCGCGGAGAAGAGCAGTTGGGGTATGAGCAAAGTCGACTATCTGT
GGCATCAGATCTCCCGTGAAGGCCTGTTCACCAAGCCGAAAGATTTGGCAAGTCTGGAGGCGTTGAAGTTTCCCAAAACGCTTAAGGCTCTCCAGTCATT
CCTGGGCAGTCTCAACTACTACAATCGCTTCATCGAAGATTTCGCAGTATATGCCATAGTGTTGTATGAGTTCAGAGATTCCGATTTCATCAAGGGTCGA
GCCACAAACGTCAGCGGAAATCACGAGGCGACTGTGAGATGGGGCCACGCGCTACGAGCCTTCGATACCCTGAAGTTCAAGATGATCAACGCACCCATGC
TCTACCATTTTGCCCCAGAGTTGGATCCTGTTGTGATTGTGTACGCAAGCAAGTGGGCGATCTCTGCCTCTCTCGTTCAGTGTCGTGATGGAGTGTACGT
ACCCGTCAAATTTACGAGTAGGACACTGCGGTCTCACGAGATCAGGTACGACATTGTGGAGAAGGAAGTACTGGCTCTGCTAAGAATCCTCGATAGCTGC
TTCACCATGCTGAGTGGTCGACACATCCGAGTGCTCACCAGACACACGACTATCGCATGGCTCTTCCGCGCGAAAGGCTTGAAGGGACGGCTAGCTCCGT
GGGCGGCGCTGCTCTCCCCCCATTCGCTAGAGATCGAACGTTTAACGAAAGGCGAAGATGAGCTACTAGGTTTGGTTGCCGCCAGTATCACTCCGCGCGC
AGAGATGGATGCAGCGTTGGGGGAAATCTCTCCGCAGAAGAAGTCGACGAGAGCATTGGCTATCCCGATGCCGACTTTTACGCCCGGAGAAAACGTTTGC
GTCGTCAGGTTTGACGGATCGGCCAAGTCGAAACGAGTTGGTGGAGCTTTCAGCGCTGTGGTATGGGATGCTCCTGGATGGAAGGTTGTCAAGGCTGAAT
CTGGCTATTTACCGGACCTCACTGTGAACGAGGCCGAGTACCATGGCCTCCTTCTCGGACTTCGTTTGATTGCCGATCTCCAGATCGACTGTCTCATTGT
GTGTGGCGACTCCAATTTAGTCATCCGCCAACTTGCGTGGAGAGATGGAGTGCAAGTCATCGGGACTCCAGCTCTTGCGTGAGAAGGCCAGAGTGATTTT
GCGGTCTTGGCCGCAATGCGAACTCATCCACGTAAAACGCGATTGGAACCAACCCGCGGATATGCTGGCGGGACAGGCGCTGCAGCGTGGTGCCGGGGTA
GTTGTCGAGAGTCACACCGATTACACGAACCTCGAGACCTTGAATCGACTGGACGAGCTCCTCAAGACGCGCGAAGAACGTGATGCCCATCCGAAGGTAG
GCGCTGTCACGCGAAGCCGATCTCGTACTGTCGCACCAGCCGTGTTGCAGGAAGACGTCGTCAAGCAGCTGCGCTTGGAACGTATTTGCCGTGCTAAAGA
AGAGGAGGTGTGGATCTGGTCACTGAAGTGTTTCCTGCACGGTGATCTCTCTCAGATCTCGAGCCGTCAAGCCAAGACGTGCAGTAAACTGGCTGACAGT
TACGAGGTCGACGAGCATGGCCTCTTGATGTACTGTCCAGTCGAGGGGCGCGGTGGTGATGTCGAGGACCGTGGATCTATGGTGAAACTGGTAATGCCGA
GTACACTCCACGAAGATCTCCTGCATCATTTCCACACAAGTGTGGAGGGAGGTCATCAGGGAGTCAGCCGAACATTCCAAAAGCTTCGGAGGCCTTTCTA
CTGGCGAGGTATGTTCCGAAGTGTGCAGAAGTATGTCGGGGAGTGCGTCGACTGCGAGACGGGAAAAGGAAAACCCACCTTGCGGGGGCGATCGCCGGGC
AATTTCGCCGCTAATTACCCTTTCCAGGTCGTGGCTATGGATCATATCCCCACCCTCCCGAAGTCGTTCAAGGGCAACACAGAGCTCCTAGTCTTCGTGG
ATCTCTTCACCGGCTTCGTTGTGGCAAAGGCAAACGCGGACAGGACCGCACCAACAGTGGCTGAGGCATACGAGGAATGCGTGTTTCGGCGGTACGGAGC
CAGCGAAGTAATCAGGCACGACCAGGAACCGAGCTTCATGTCCGACTTTTTCCGGTCGTTTAATGCGCTGCTGGGCCAGCGTCAGCGATCTACGCTCGCG
TATAGACCTCAAGCAAACGGCACAGCGGAGCGGATGGTCTTGACTATTTCCAGATCTCTGCGGATGTACGGTGAAGACAAGAACCAACAGGACTGGGATG
AATATGCGGAGCGGTTGGTGTTTGCGTTGAACACATCGCACGACCGAGTACGCAAGGACACGCCATTCTTTTTGCTGCACGGGTGGGACCCTAAAACGAC
TGTTGAGGCATCGTTGGCTGTTGGAGGGACCGGAAGCCGAGACCTCGACCCACAGAAATGGAGGTTCAAGATCCAACGCCAATACCAACGTAGACTCGTC
GTCTCCTCGCCGAAGCTCGTGAGAGTCGCGCGGAAGCCACAATGAGAACGTACCGGAGTCACCCGTTAAGGAGGGATCGCAGGTGTGGCTGTACCTCGAC
CGAGTCAAGTTCGGATACGCTCGGAAGCTCGCTCACATGTGGCATGGGCTTTTCAGAGTCGCCACCATGGTGAGCGACTACGCTGCCAAGCTGGAAATCA
GCGGGACTGACTACCGACTGTTCCCTATCGTACACATCTCGAAGCTGAAGCTGGTCCGACAGTTCCCCGAACGATCCGCCGAAGATCTCACTGTTGATGG
AAGCGAACGATTTGATTTTGACGAAGAACTTCTCCCTGAGGATAGCTGGGAGGCACAAACTCGCGGTGACAACGAGTATGAAGTTGAAGAGATCTTGGAT
GTCAAGACGGAGAGACGCACCCGCTACGGTCGACGGCTCAAGGAATATTTGGTGCGTTGGAAGGGCCACGCAGAGACGAATTGGGTCAAGGAAGAACACC
TGAACTGTGGTGGTCTGCTGTTCGACTTCCAGCAGAAGCGACGGAGCCGGCAGAGGTTCCATGTGATGCTATCGCGTGGAGAGG