Description :
From Genome Similarity Track
Location :
Scaffold_156:19146- 20551
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_156-snap-gene-0.17Phospholipid-transporting ATPase

Sequence
1405 bases(100 bases per row)
CTAATAGTGTGTGaTTaCGGTAGGCTGTACCGAAGAACGAGTAAGGAAAGAGCAGtGACTGAGTCGCCTCCGCAACGTGTTCTCCACGACTTTTGCTTCC
CAGTCGGCTCCCAACCAGtGTTTCAATCTCAAATCCATTATACCGTCGACAGCCATCGACACGCCAACGCGGTTCCTCTGCCTCCTACTTCCGAATGGAT
GCAGGAGAACCGATGGCCACGAACGACTTAATTCTCAAGTGTcTaCCcTACGTCTATGTGCATCGATACGGCGCGTcGTCCGTTCACTCGCCACTGAAGG
GCTGCAGCCCTTTACTTGAGGCAAAGCTTCTCTTGAGCATCATCTGCGTCTCCGTCGCGCTTGCGTGCGCATCCATAGAGAAGGCGAATCCGTGGTACCC
TTGGGCCATACTGCCATGTGTCTTGGTCTCTCCATTCTTCcGacccccGGCATCCGTGTTGgTCGGGATAACAAGACTGGCGCGTACTGTTGCGCCGCGC
ATaTTTCGTGTTTTCGCGGGTACTGGCACTGCTGAAGCGCTCGTGTCTTCGCACTGCAGACGACTGTGATCCAGGTTGAACTTCGCCGCCTCTTTCACGA
GATGCCAGTACTCTGGATACAATGCGATCTTGGCACCCAACAGCAAATAAACGGCCCACAGCGATGCCACTGGCGTGATCAGCATGAGCAGCCAGAACGT
GGGAGTGTCGAAGGTTTGCTCTAACATTCGCTCCCACGCGAGATCCGACAGGCCGTCCATATGACCGGCGACGACGGCAACGAGCAGCCAAAAGgCGATG
GATCCCCAGTAGAAGAAATGGTTGAACGCGTGGAAGCTGTTCTGGAACAGCATCAACTTGACGTTGGCAATCACTACAACGAGTGTAAAGATGATGTTCC
CACCCAGCCACATcGTCGTGGATGAACCGTACAGAGCACCATTTTGCACGCCGTAGATGGCAATCAAAGTGATCACAACGGACTCATAGATCGCtCCGAG
TACCCACGAGgTGAAGaTCTTGGGGTTGAGGTCTTCGTCGCGTGGGCCTGTCGAGTACAGCTTGGGAAACTTCATTGCCATGGTGTCGCTCACGTCTTGG
TCGAGAATGGACAAGATAACGATCGGTAGAGACGTCAGCGAGATGTTGTACAACTGCACACCAGTCTCCAAGAAGAATTTCTGACCCGAGAATCCACACA
TACTAGTGTACCAGTATTGCGCGGCTGTAAAGAGGATGTTCTTGTAGAAGATATATAGCACGAGCTGCGCCATTCGCCGATAATTCCATCGTCCATGcaC
AAGAAGAAGTCGCTCGAGAAAACGGAAACGGGCGATAGCGTAGTCGCTCGAGTTGACGGCTTGCATACCTTCCTGACCAGAGATACCGACGCCAACGTGG
GCCTC