Description :
From Genome Similarity Track
Location :
Scaffold_63:19142- 21311
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_63-fgenesh-gene-0.4Lysophospholipid acyltransferase
Pytir_DAOMBR486maker-pir_contig_63-snap-gene-0.38Septum formation protein Maf
Pytir_DAOMBR486maker-pir_contig_63-fgenesh-gene-0.5Dynein heavy chain

Sequence
2169 bases(100 bases per row)
ATCCAACCTCCCAGTGCCTCTCGCGACGTCCGTGAACCGCCTGGCGTACAAGCGCGTGCGTCCGTACTTCCTGGAGGCCGACGGCTCGTCGGGGCTGAAG
AAGAAGTTCTACGACCTCGTGAGCGTCATCGCGACGGTGCTGACGATGCACTACTTTGTGATGCCGTTCCAGGCTATGAGCTGGGATCACTCGCTGGTCG
CGCTCAAGAATACGCACTACGCCGGCCATATTATCTGCGCCGTGCTCTACGTCGTGTTCTCACTCGTGCCCATGCCAAAGTCCGCCAAGAAGACCGTTTA
AAAGAGTGCGTAGGTAGACCAATAGCAGCGAGGAAGAAGACTTGCGTCTTTTTTTGATAGAAGAAAGAGCACATCGAATTCATCAATGATAATCTGGTAC
TCTGTGTGTTCATGATGGAGGTTGCATCTCGCAACATTGTATTCGCGTCGCGCTGTACCATTCATCAATCATTCCTTCTATTAGAGCTTGTCACTGGCCG
CGAGCAGCTTGAGCTCCTTGCAGAAGCGCTGAACGGGGAAGCCCATGACGTTGTTGTGGCAGCCGCTCAGCGCCTCGATGAAGCAGCGCGCGCGGCCCTG
GATGCCGTATGCGCCCGCCTTGTCCATCGGCTCGCCCGTGCGGATATACGCGCGGATATCCTCAGGCTCGAGCGGACCGAATGTGACCGTGGTCTTCTCG
AAGAACAGGTGCGGCTCCTGCTCGCCCAACGCCGACGTGAAGAGCGCCACGCCCGAGTACACCTCGTGGGTCGCGCCTGAGAGCTTGCTCAGCATCGTGA
ACGCGTCCTGCTCGTCGCGCGGCTTCTCGAGGATCGCGCCGGCGTGCACGACGACCGTGTCGCAGCCGATGACCACGTGCTGTGCATCACTGGTGATGCT
GGTGGTGGCTGCGGCGTTGACATTTGTGCGACGCATGACCTCGAGCGCTTTCTGCTTGGCGTTCTCGATCACATAGAGCTCCTGGCGAAGGGGGAGAGAA
AGAGCAATGTAGCAGAGATGAGTATCCAGTGGTGGCTGTATGTATGGACAAGAGAGTGACTATAGCAGGCTTACAGGCGACGCGAACTGCTCTTTCGGCA
GGTTCTCTTCGAAAGTGGATGGGATGACTTCAAATGTGAGGCCCTGAGAGGTATCATGGCACACCATTGCGGCCACAACACGCGCGTTAGAGTTTCCAGC
CACGAACGCATCAAGGGCGAGTCGCTGAAGCCATCAGCAATGTCAGTTCACGACAACGGACGTACACATTCGCGGAGTAACTCCAAGCGGCGCGGGCTCT
GTGCAACAGTAACACATGCACACACACAGAGAACCAGAGAGCAGCAGTTTGGTTTGCCAGTCAGCTCATGTATCACACTGTTTGCACACCATGCGAGCAG
CAGTGTGTACCTGGGACGCGAGGATCACGCGTCGTGCGGCGAGGTGGCTGGAGAGCGCAGAGAGCATTGCTGAACAGCAAATGGGCGGATCCTTTTACAA
AGCGGGTGGGTGGTTGGGTGGTGTTCTTCCACTCAGCAAATTCCAAACTGCCGCGCCAATTTCAACAAGCGAATGCGAAGGAAAATTCACAGCTCCAGAG
AGTGCGTCATGTGAGTGAAGGTGGCGTCGTGGCTAATGGCGCGTGGCGAAAGCGCAACAACAAGCGAATGAAGCGCAGTACGGAGACGGCGCGAGAGTGA
AGGTGGCGCGCCTCGCATATCACGCACGCGCTGTGTGAGTTGAGCTTCTTGGTGTGGCCTGGACAAGTCCCATCAACCCAGAGGATGTGACAGCGTCAAG
GCCGTACGTAGACAACAACGTGTCGTCACCACCAGCAGCAGCATGCCTCAACACCTGCTAATACCCGCTATATGTATGTGATATGTGCTGCTGCTGGCGG
TTTGTCGTTTGGTATGTCGTTTCAAAGTGGAGGTGAAGTTGCCTTTGGGAACGTTACTTTTTCAAGCCCGCGTGCGTCTGTTCGCGGCCCTCAAGACTTC
TGCAGCCATAATGAACGAAGGCCTGCAACGTGACGGAAGCACCACAGTAGCAGCAGCAACACTCGCATCGGGCTTCCTGCACGAGCCTCCCGTCGTGTGC
ATGTGCCATAGCTGAGCGCCAGCAGGTCATCACTCCGCATGTCGTCGTCCGAGGGCGGTGGTGACTCGC