Description :
From Genome Similarity Track
Location :
Scaffold_101:191336- 197795
Transcript NameFunction/comments
Phyin_T30-4PITG_19668Putative uncharacterized protein
Phyin_T30-4PITG_19669Ubiquitin-like protein/ribosomal protein
Phyin_T30-4PITG_19670Putative uncharacterized protein

Sequence
6459 bases(100 bases per row)
ACCGCCTCCGCCGTCTAGGGTTAATATTGGGCCCAACGCTTCCGTAGTTAAGATCGAAGGGACCCCGGAGCCCGAAACGTCCGCGGGTGGCTCAATCCCA
GTGCCCGAGCTGTTCCCTCCAAGCCGGTTGACGGCTTGGTGTAGGATGTTTTGTAGGTTTTGGAGGCGTTGCGTAGTTGACAGACTGGGTCGCGTCCTTG
AAGGTAGACTCCCAGTCTGACCTTCTCCATCTCTGGAGGTGTTGCCCGCGTTTTCTCCGGTGTTCGTAGATGCCATCTCGTTCGTGTAGTAGCTTCCTTC
TTGCGTCCTCAGCGAGTCTTTACTTGAATCGAGAAATTCTCCAGCGAACAGACTACCCTACTTCTCCACCAAATGTCGTATACCTCCACCAACAAGGGTC
GGGTAATCCGCGGCTGCTTAGGGAGTGCGGTTTCGCTCAGTGGCCGGAACGGTAGATAAGAACACTTAAAGTGAATAACAATTTCTTTATTAACTTGGCT
TCCACTTGAGTAGAAGGTGGGAAATATAAGACTGAGAGCTAACTGGAAGAGAGGTCTAACACCTCCCCTTCCTCACATACACTACACCACTTCTCTTACA
CTTGAACTAAGAGTTCGCCTCACCTGCCATCCGCCCTCGTGGGACAACAGGGAGCTCTGGGAAGGGACCCGATTGCGCTAGGCGCCTTAGTCGCACGTCG
AACGAGTCTCAATGTTTCCGGACCACTCTATAGGGTCACTCTAACGGGCTCGGCCTGGGGCAGCGAGCCGCCGAGTTCAACGGGTACCATCCTGACGGGA
CGGCGGGGCGAGGAGTAGCCACAGGACCTCGAGTCATCCCTTCAGGACGCCCTACTCCTGGAATGCCCCCCTCGTTCCCGGATACGGGACACAAAACAAG
TACTTCTCTGTCCCATAAGGATTTCGTTTTGTGTGTCATACACGAAATATGCTACAATGATCCCATTGGCTGATACCATGCTTCTTTCAATTGTTTGATG
ACATTTTCCTCTGATTTGATACATATCGACTTAACAACCAGTAAAACCTCATGTAATTGAGCGCCTAGTGGCGAGTGTTACACACATCGATCGTGATTAC
GCTGATGTGTACATGTATAGGATCGCCATATCGGAATGAGCATTCACTGCAAGTTTTGGAAAATTTCGCTATTTAACCCACGAGTTCCGAAAAATAACAG
AGGGCCTTTTTATATGAGCCCACATTCACGACGTTTCCGGTACCTTTAAGAAGCTACAAAAAATAAAGCCAATAACACGCTGACTCAAGCTTTCGAAAAA
GGGTACTTAAACCTCACATTGGCTCAAAAACCCAAAATCTCTAAAAATTGGTGGGACAGAGAAGTACTACATGTAATAATAGAACTAAACCTAAACTACC
GCCGCGTAGCGGCGGGCTCGGCTAGTTTACTACTAAAAGTAAGTACTAGTAGTATTGCTATGGTCAATGTACATTCGGAGGCCCTGTTGCTACGTTATCC
GGAGCTTTCCTCGCAGTGTTATTTGTAAATTGCTGAACGACACCAGCCCGCTTTCAGTTGTGTCCTACTAAGGTTAGCTTTCATGACCAACATATCGACT
AATGTTGCAGGATCTCAAACGCTCCTGCATCCTCAAAACACAGTTCTTACGAACTGCGAATTCATGAACTTCGAGCATATCTAGATAGCGTTCCTTAACT
CAAGAAGTGACCGAGCTATGCCCCAAAAAGTTAGTGGTCATAATAACCTGGCGCGCAGTGTAGCTTATTCGTCACTCTACTTTGCGTTGGGGTCAATGTG
GGTTGCGGCTTCCTCAGCGAGTTCCAGTGCATTTTCCACAAAAAAAGCTTTGTCAAATGCCACTTCCTCCAGCACGCCATCCTCGTAGCTGGCCTTGTAC
GTCGTGAGCAGCTGCTCATCATTCTTGCGGGCTAGTGACTTGAGCATTTTAAGAGCCTTCTCGTTTTCAAAACGTCCCTCCTTGTGAAGCTTGTTCAGCA
TGCGCAAGACGTCACTGGACACGGCACTTTCAGTGGGAGGAACAGCAGAAGGCGTTGTTGCAACTTCAGGTTCGGTCGCTTGAGTTGCACCTGTCAGTTC
AGCGAAGACATCATACATAAAGAAACCAGCACGCTAAGTTCGGAGCCACTAACCCGATCTACATACGCACGCTTAGTGCCTAGGTAGGTACCTTCGATGC
AACGCGGATTTTTCGTCAATATCCTCACGAACGGCTCAATGTCCCCCGCTGTGGGCACAATAATGGCCAGCGGCTGGCCTGGAGCAACGTTGCTGGAGCC
CTCATTCACCACTGATATCACGAAACAGCAACGAAGAGAAAGACGAACACACACACGCATCAGTCACGGTCGGAACTTACCGAAGCTGGAGTTTATTCCA
CTCACATAAGCGTGCGACGAATCCATCGTCACCAGACTCGAGCTGGAAGCACAGGTCCGGCGTGTCAATCTACCAATCCAACAGCAGTAGCAGTAGCAGA
GCCCCGTAAGTTCTTAGCTCTGGCAGCTTTCTGGATTGTCGTACCTCGCACATGTGCGTGCCATCCGTCACAGCCGCCCCCTCCTGCACGTACCACTTCG
TCAGCGTCGTGTCCCCGGCACCACTACCCACTTCCTGCGTCAATCAAATATTATCCGTGAGAACTTCGCATAAAACCTCGTCCCTTGCTACACAGTAAAC
GCCATGCACCTTGAAGTCCAGATCCGGCATTCGAAACTTGATGTGACTGGGTAAGTCCACTTCCTTGTGCTTCTCCTCGCTCGGCGGAACTCCGCTATCC
ATGGAGAAGAGAGCGGTTGAATGCAGTACATTCGCTAGCGTGCGTCTCACAGTCAGTGCCACTCTTCGGTGGCCGTGCGCCGCCAGAGCCCGAGACGACA
GCATCATGTCAGATGCCAACAATTGGTTACTCTAAGTGAATCTTGGCTACCGGTACTTATTTTACTGTTTTTTCTACAGAATTCACTCGAAGGACCGGTT
AAAACCATGTGAGCCACCTTTAAAAAAACGTGCGAAACATGTTTTTCTGTGTGCCACACCGTTTAGCTTGGGTGGTGGCTGCATCACCACCACCAATCGC
CGCCTTATTTTCCACCCACCTCTTGGAAGCTACTATCATTGGAATTCTCCGCGAGAAACGAAAGGAAGAAGCATGAGGTGAGTCTTGATAGCGCTCGTGG
CCGCGTACAGCATGCTGAGATGCAGCTCATGCCGGCCATACAGATGCAGCACAGCGTACTAACCTCTTTCTACTGCATCGTTACCTTGTCTCAGCAACAC
CAGCATTGAAAACGCGACCACGCTGAACCTGTCCCTCCGCCTACGTGGTGGTGGTAAGGTCCACGGCTCGCTGGCACGTGCCGGTAAGGTGAAGGGCCAG
ACCCCCAAGGTCCCCAAGCAGGAGGACTCGAAGAAGGCGCTTACGGGCCGTGCCAAGAAGCGCTGGCAGTACAACCGTCGCTTCGTCAACGTCGTGGCGG
GTATGGGCGGCAAGAAACTTGGCCCAAACTCGAACGCTGCCAAGCAGTAAACAGGCAGCCAGTAGGCTGGACACAGTCAGTGGAGATCGGCGACGTGATG
AGCCGAGTGTGTGGCATCGATGCAGGTTTGGCAGGCTTCCCGTCTCTCTCGACTGTGGGCACCATCCCCTTCAGGCAGTGGTGGTGTCAGCTTCTCTTCT
GTGGCGCCTTGCGATCCAGCTGTCTTGGTGGCGGTCGTTGGCGTAGATTCCTCGGGAGCTTTACGGCTCCGGTGCTTTCGCATATTCCAAAATCAACCGA
ATGCTAAATTTAACGCTCAGGTGTCGCTTTTTTGGTCTCGTGCAATCCGTCGTTGACCCTGGTGTAGTAGTGTAGCCTTGTGTGAACTGATTTGCAATCG
TCACATTCTTTGTTCCTAAAGTTACTTTTCGACATGCTGCTGTTGTTACTTCCAACCTGCCATGCGACGATGTCTGAATGGAGTGCTTTGGTGAGTGCCC
TCTTTCCGGAGTACAAGTTTAGGTCATGTACAGCGATGACTCAGTTGCATCCGAGGTGGAGTCTGAGGTTGAGAATGTCTACGGCGATGGCGGCAGTGTA
GTTGCTAGCAAAATTGCCGAGAGTGGTGATGTCCTCAAGCCATCACCGGTGTTGAAGCAGCAGCCCAAGCGTAGCAAACCTGCAATCTATGACGCGTACG
AGGCAAACGATGATGACTACAGTGCCGAAGACTTCGAAGACGATTTTGAAGAGGACGAAGTCGAAATTTCTGCCATCCATCCCGTCCAGGCATCGTCGCC
CACTCGCTCAGTCACAAGCAACACTCGCCGCTCGGTAGTAGTTTCTGATGGCGTGTCGGGATACGACTACGAGTATGGTGAAACCTCTTTCGAAGAAGAA
AGTCGTCGCTCGCAGAGTCAGCGCAGCTTGAGGCAAAGTAATCGCGTCGTGGATCTCTCAGTTCGCGCGGCATCATTCTCATTAAACCCAGCACAACCAA
CATCAGAAAGCAACAAAGACCTCACACAAATCAATGATGTGCTCGCTCCGGACGTTCATTCACCTGTGGCAAGTGCCAAGGTTTTTACAAGACCCACTTC
GCAAGTGCTCGCATCGGTTGCGGTAGAAGAAGCTGAGGCTATTGCTGCCATGCAGAGCAAGCAATTTTCGTTGCTTTTACGTAAAATGGAGAGTAAGTTC
GAGGACGAGATCGATAATCTACGCGAGAAGAATGCTTTGCTCACATGGAAGGAGCGCGAGCTGAAGGCGTCACTGCGGCGAGCGAAGGAGGAGCTCACGA
TGCGCAAGGCACGCATCGAGAAAAAGCGTCGGCGTGCAGCTGACAGGCGGCGGGAACACGAGCGAGCAGCAGAACGTGTGCAGCAGGAGCTCGTGGCTGC
TCAGTCTTTCATCGTGGAGCGAGATCGTCGAATCGAGAAACTGCAACTCGACCTTGTCGAATTGCGAGGAGTACTTCAGAACGTGGAGCGAGAGAAGCAT
GAGGCGGGGGAGCGCAACATTTCACTTGCTGAAAAGCTTCAAGCAGCACTTGGAGACTTTCATCAGCTCACATGCAGCTTCGAACACGCAGTCAACGCCA
AACTGGCCTGCGAGCAGCGTATCGAAGAACTGAAAGGGATGCATCGAGTACAACTTGAAGTGATAGAGCATAAATGTCAAGTCGATGTGGACGCTGCTCG
TCGAGCACATGCCGATGAGGTTGCAGCGCGCGTAACTGAACGACAAACGCTACCAGAAGCTCACAAACGTGTCGTGGAGGCGGAGAAAGAGCGCTATGAG
ATGCTGGAGACTGCCTTGAACAATCAGATTCATGAGCTGGAGTCTCGTACAGCCCAGGATACTTTGGCACACGCTGCGGAACTTGCACGGGCTATTGAAG
CTAAGCACCGGGCTGAACAGCGGGCAGACAGACGGATACAAGATGAGGTAGACCGGGTACGAGTATGTCATGGTAATTTGCAATAGTCAACCAGCTTTCT
CTAACTCGTTGATTGGTAACCAATGTACTTAAAGATTGCACGCGAGCGCGAAGCTGTAGATGAGCAACGACGCGAGCTGTTGGTATCAATGGCTCGCACA
AATGCTCGCTTCGACGAGGAACGAGGCAAAATGGAGGCACGGAGTTGCGAGCTGGACGCGCGGCGGCGTGAGCTCGCAGGCGAGCGCGCTGAGCTCGAGG
CTCGTATCGGATACATTGAGCAACGCATACGACGTCTGGAAGAAGATGAGGCGCTCGTCGAGAGGCGCCGCACAGAGCTAGCCGCTGTCGGGCGAAAAAC
GTTGGTGGAGTCGCACGCTCTCGCCCGACGTGTGCAGGAGTTTGCCGACGTCACCGAAGAGCGCGATAAGTTGCGCTCTCTCGTGAAGGTTCTGACGGAA
CGTTCAGAGCGAAGTGAGCAGCGTGCAATGATGCTGGAGCAGGATCGTGAGAAGTTGGAGACTGCCGCGCATGAGCTTCAGCAGGAGCGATTGCTGGTTG
CCAAGCAGCACATGCAATCGCGCTACTTTTTAAACGGGGCGCGCAAGCTCGAGAGTATGCTACATCAGAAGCACTGCGTCATGGAAGCGGCAAACAACAG
CTCTCCAGCGCGTTCCAAACCGTCTTCAACAACAAGCAACCAATTTGAACCAGTGCTCGAAAAAATATTTTAATATATCACATCTTAAACATCTACTGCA
GCAACCTGTCTGTCCGTCACACTAAATTGTCGTGCCTGTCACGCTTTTCCGGACAAATCATTGGATAAAATAATTTAAATATTCCTACTGGCTGCCGAGC
GCAGCGAAGGTGGCCCCGATTGGCCTAAAAGCTGCCGAGCGCAGCGAGGCGGCCCAAATCGGCACCTTCTGCAACCCTGCGGGCCTTTGAGCCCGCCTGA
GCCAAATCTACCAACCTACCGTGCGAGTAGTGAAGCGAGCCCGTGGCGAGCGGAACGGA