Description :
From Genome Similarity Track
Location :
contig_15:19122- 20469
Transcript NameFunction/comments
g3962.t1hypothetical protein

Sequence
1347 bases(100 bases per row)
ACACGTGGGTATGTGGTGTTGTGATTCACAAAAACTTCGTTAGTGCGGCTTCCACGCAACAACACAACAATTCGCCGAGTCAGGTCGGCGTTGTTGGGCT
TGCGCAGGGTTCTGTTGGTTCCCTTTGCGGTTCGGCCCAGCCGGGTCCAGTTGAGGCCCTGCTCTCGCTGAGTACCAATCCAAACTCCAGAAGCTCGCCT
GAGCGGGGCAGCTTCCGTTCCTCAAACCCTGTGACCTCCACCAAAGGATGGACGTCGGCGCGCGAGCGCTTTTACAGGTCACCGAGCGCAGAGTACGCTC
AGCTAGAAGATTGCGGTGTCCTGGGTTGTGCAGACCCACCGACTCGTCGATTCGACGAGGTTTGTCTTCGTTGGTAGCGAGAAGTGCCCACCCCGGGCCG
ACCTTGATCTCTTGGCGCTACCAGTCGATTCCCCTACAAGCTATGCCTCTCGGGGAACGACGGCAGACATAATCCAGCCCACGCAGGGACTTACCGGAAA
GTATACGCTGTTCTTGGACTTAGAAGATTCTGCTCTGTTTTGTTATCTCTGTGTCTTCGGGGAGTCCCTTCGGGCTCCCCCTTTGGTCTCCTATCGATCC
TATACAAATACCTAGTGAAATGGATCGTTATAGATCTCCCTGCGACTCTTCGCTCAGCTTCCTAGTTGATCTTCGCCGAGTCGGGTCGCTATGGATCTCG
GCCGACCCTTCGCTCCGATTCTGATTTATCCTCTCCCAAATGGAATAACTCCCAAATGGAATACGCTCGCTGAGTCGCTGAGTCTTGGTGCTCGCCGAGT
CCGACCGATTCGCCGAGTTCGCCGCTTAGGTGCGAACTCCGATTAGGTACGACGTACTTAGCTGGGCCAGAATGGGTGGTCTACCCAAAATATGAGTTTC
CCTACACCACAACTGCCCCGGGCGTGATACGAGCCAGGCTGGTAAGTGTCTCGACCATCATTCAGCTCTCCAATTCTCAACCGTCGGAACTTCGTTCGAA
ATCTCGTTACCACCAGTCCACGAGCTCGTCGAACACTCCGTCACCTTCTTCCGTCGGCCAGGTGCGTACTGTTGCTTTCGGCGCCACTTGTGCTTGTTCG
TGACGTGCTAATACCGCTCTCTTGTGCTTATGGTAGCTTCTCGTTAAATCGCTGCGCTCATCGCCGGTCCTGTTGACGTGTACACTCGCTGTGTCTCGTC
CGACTTCGTTGCGGTGGCGTTTGCCTACGTTCGTCTTCTCCGGACCTCTGTTGATTCATCGTCGAGTCTCTTCGCAGCAGATTTTACGTTGGCGATCTTT
TCGACGACTCGCTAGCATGGTGCATTCGCCGAGCCGTGCTGGACCGC