Description :
From Genome Similarity Track
Location :
contig_15:19120- 20468
Transcript NameFunction/comments
g4140.t1hypothetical protein

Sequence
1348 bases(100 bases per row)
GGGACACGTGGGTATGTGGTGTTGTGATTCACAAAAACTTCGTTAGTGCGGCTTCCACGCAACAACACAACAATTCGCCGAGTCAGGTCGGCGTTGTTGG
GCTTGCGCAGGGTTCTGTTGGTTCCCTTTGCGGTTCGGCCCAGCCGGGTCCAGTTGAGGCCCTGCTCTCGCTGAGTACCAATCCAAACTCCAGAAGCTCG
CCTGAGCGGGGCAGCTTCCGTTCCTCAAACCCTGTGACCTCCACCAAAGGATGGACGTCGGCGCGCGAGCGCTTTTACAGGTCACCGAGCGCAGAGTACG
CTCAGCTAGAAGATTGCGGTGTCCTGGGTTGTGCAGACCCACCGACTCGTCGATTCGACGAGGTTTGTCTTCGTTGGTAGCGAGAAGTGCCCACCCCGGG
CCGACCTTGATCTCTTGGCGCTACCAGTCGATTCCCCTACAAGCTATGCCTCTCGGGGAACGACGGCAGACATAATCCAGCCCACGCAGGGACTTACCGG
AAAGTATACGCTGTTCTTGGACTTAGAAGATTCTGCTCTGTTTTGTTATCTCTGTGTCTTCGGGGAGTCCCTTCGGGCTCCCCCTTTGGTCTCCTATCGA
TCCTATACAAATACCTAGTGAAATGGAGTCGTTATAGATCTCCCTGCGACTCTTCGCTCAGCTTCCTAGTTGATCTTCGCCGAGTCGGGTCGCTATGGAT
CTCGGCCGACCCTTCGCTCCGATTCTGATTTATCCTCTCCCAAATGGAATAACTCCCAAATGGAATACGCTCGCTGAGTCGCTGAGTCTTGGTGCTCGCC
GAGTCCGACCGATTCGCCGAGTTCGCCGCTTAGGTGCGAACTCCGATTAGGTACGACGTACTTAGCTGGGCCAGAATGGGTGGTCTACCCAAAATATGAG
TTTCCCTACACCACAACTGCCCCGGGCGTGATACGAGCCAGGCTGGTAAGTGTCTCGACCATCATTCAGCTCTCCAATTCTCAACCGTCGGAACTTCGTT
CGAAATCTCGTTACCACCAGTCCACGAGCTCGTCGAACACTCCGTCACCTTCTTCCGTCGACCGGGTGCGTACTGTTGCTTTCGGCGCCACTTGTGCTTG
TTCGTGACGTGCTAATACCGCTCTCTTGTGCTTATGGTAGCTTCTCGTTAAATCGCTGCGCTCATCGCCGATCCTGTTGACGTGTACACTCGCTGTGTCT
CGTCCGACTTCGTTGCGGTGGCGTTTGCCTACGTTCGTCTTCTCCGGACCTCTATTGATTCATCGTCGAGTCTCTTCGCAGCAGATTTTACGTTGGCGAT
CTTTTCGACGACTCGCTAGCATGGTGCATTCGCCGAGCCGTGCTGGAC