Description :
From Genome Similarity Track
Location :
scaffold_51:191195- 193434
Sequence
2239 bases(100 bases per row)
TTGGCACCGTCGTCGCCgatggaagagctggtgcagcttgcAGAAGTCACTCACGATGACTCCCTACACAACCTCAAGTGTGATGGTCGTGTTGCTACTA
TCAAACGTCCATTCAGCGAAATtacgctcatcatcagttaTGGATTATTCGTTTCTCGGCGCATTTCGACAGCGTGTGGAACTACGCCGAGAATCTGCTA
TTTTAAAAGGTCTAACTGGTTCACCTGTCATGGAATACAAGGATGACGTCCTTAGAGTTCGACATGAAATTGATTCTGAACCTGGTTCAAAGCACTGTGT
GCTTGACAGTGGCCGCTGTCGCGTGTGCAAAGTGGATACATTGATGACTTATTTGCTTAAAAAGAAGCTGCTGGCTTGCTCAAGGAGACCAAGTCCCCTC
ACAGCGCGCCAACGTGTTGTGTGTGCAAACCAAATGGTTAATGGGGTATCGTTCAATCCTTACACAAGTTCAGTGAGCACACGATTCCTGCTCAAGCGCC
ATTTTTGCGTTAAGATGTCATCATCTACCGTATGTCCGGCTGTACCCGATTTATTGTAAATGATTTAGTAGCTGGATATTACCGAATCTCGATGAGGGAG
GAGGATGCATCCTTGACGGCTGATAGTACACCGTTCGGTATGTCatgggagtggcttgtgataCCACAAGAACCATCCAACTGCCCAGTAAAATTAATCG
ATTGGTCCGCCATATGTTTCGACCACTGCGATGCTTCGCACAAACATAGATTATTCGTTCATTCAAAGGGCGAAGATCTGCCGAAGAAATGCACTCGGAG
CCTCTTCGTGCGGTGCTAGGATGTATGCGTGAACATTCATTGCCATCAAATCTTGCAAAATGTATTGTTGGTGCCAACGAAGTACCGGTCTTCGGTTATT
TTGTCGGTGAACACGGTGTTCGTGCAGACCCTGAGAAGGTGAAagcaatcgtggagtggccaaTACCACATAAtaaaaagaatttgagaaAATGGATTGG
TCTGTCCAATTACCTGCATCGCTTCTCGCGTAACTACACAGGAGTAGTACACCCACTATCAAACTTGCTATAAAAGACCATAGGAGTGGTCATCCACTTG
TGAATATGTATTTACTCAAATCAAGAGCAGTTTGGTGGAAGCACCATGACTTGCTTTACCAGGTGGTACGAAGCCATGTAGCGTGAtatgtgacgcttct
gagtttgcgatcggctgtgcactattGCAAAAGAGCTCAGAAGAACACGATTGTGTCGTGTCATTTAAATCGCAATAACCGAAGCCAGCAGAAATGAGCT
ACCCTGTAGCCtttggcaatgaagtatgctttggTAAAGTTTCGTGTTCACAACTTGGATTAAACTCCGTTTGTCGTCTACACGGATCATGCAAGCTTGC
GATATGCAGTTCAGTCTTCTCATTCAGCACAGCAGATGGCTCGCTGGTATTCAatcttcgcagaataaaaACTTCACGGTCGCGTACAAACTGGGCAAAA
TGACGCAATGTCACCTCGCCCCAATTATGAGCTAGCACATATTAGCTAAATCGAGAACGCTGTATTTGatatgatacgtcgagcGTATGTTGAGAATGAG
CAGTATGACTGATCATCAAGACACTGTAATCGAGTGATTCGGAGCTCCATGACAGGCTTCCTGGTCGCTTGAAATGACGGATGCATCGTTACGCATTGAT
GGGGTCTCCTTTACGATAAAGTTGCACGTGGCGACCAGCCACGGATTGTTGTTACCCACAACGATGATTTAAAGTATAGGCTCGTGTGCGAGGCGCATAA
TACGCCGATGGCCGGTCACTTTGGCCGTGAGAAAACCTACCAGTCTCTCAGCTCCCAAATTCGGTGGCCCCgcatgtacaagtgggtTGCACAATACGTA
AATACATTCGATGTCTGTCAGCTGGTGAGAACGCCCGGTACACGCAAATGCTACGCAGTGTCTCCAGCTCCTACTTACTTTTCGAAGTCATTCGGTTTCG
ACTACATCTTCGTTGCCGAAGGTTCTGCTAGTTTGTTCTTAATCACGTATTCCGCAATTACGGGTTACCAGACGCTATCCTCTCCGACCGTGATACACGA
TTCGCAGATGGCTCttggaaaaaaatgtttcaaATTCTAGGCACTCGCTTGGATATATCTACAGCAATACACCCGGAGATCAATGGGCAGGCAAAACGTG
CCAACAATTGGTCGGTGATGTTTTGAAAAGCTTCTGTGC