Description :
From Genome Similarity Track
Location :
Scaffold_364:19113- 20183
Sequence
1070 bases(100 bases per row)
AGTTGGTTGAAATGGAGCTACCACACATTTCGCGATCTACGAAGGGCGACCACCTTGGTGTTTTGTCGGCGCGTAAGAAAGCTTGTTTCATCCAAGTTGA
AGATGCGGCTTGCGTCGAGACGATACTCAGTCACGAGCTTTGCCATAGTATAAAACAGAACGCCGAGATTGACTTCAGTGCACCCGTTTCTTGCTCGCGA
TATTGTCTGCACATGCCTCTTAGTCAGCTCAGGGTGTCGTTGCATAAAGCGGTGGGACCACCCGTCAGACAGGGCGCGTACAACGCCGTGGAGACGAAAG
GGAATATCGCTTGCTCTAAAGAGGAATTCTCTGCGCGTAGCTGGCGTACCGTTGAGCTGCATCCCGATTACCCATTCGACGAGATGTTTCTCGCCGTCTG
CAGTTAAGATTGAAGTGGAGCCACGTCGCACAGGGGTGACCAGCAGATTGCTCCGCTTGGTTTTGACATACTTGTAGAGAGTGCGCAACGACACTCGTGT
CTGACAGATACGATGGCGTACCGTTGCACACCCGCTGAACGGCGTCCTCGAGAGCTGCATCGGTGTATTGTCGGCGGTGCGCATCTTGTTTTGTGATGTA
AGTAGACCAGGCAGGAACGTTTTGAGCAGTCTACAGTCATTCGTTAGGGTCATATATTATTGAAGGATGAGCGTTATCATGCACAACTGTTATTTTATCC
GATCAAGACACTTAGTGATTTCCTTGCTCAAGGCATTGGACAAAAACATTTGAGTGCACTAAACTGGTCGTGTGCATTAAAATGAAAGTTTATGTTATAT
AAGAGTCGGCAACGATGGAATCAGCTGCTTGGGCTTGGGCTGTATGTTTGGTGATCTAACGTATTACCTATTGGCCATTGATGCCAAAACTGTCAACTAA
AAGACGTTATCATGTAGGAAATCGTGTGGTGTGCTGTTTGGTCGGTCAGGCATTCTGACTTGTAGTTTCGCTTTGCGCCAGGCGTTTCGAGTCAACAGGG
TAGTCAGCGAGCCAGTTGTACAATGAGTGATGCAGAGAGCTCTAGACAGCGTAGTGTGCATGCATCGGAA