Description :
From Genome Similarity Track
Location :
scaffold_15:19111- 20459
Sequence
1348 bases(100 bases per row)
GATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTATGTGGTGTTGTGATTCACAAAAACTTCGTTAGTGCGGCTTCCACGCAACAACACA
ACAATTCGCCGAGTCAGGTCGGCGTTGTTGGGCTTGCGCAGGGTTCTGTTGGTTCCCTTTGCGGTTCGGCCCAGCCGGGTCCAGTTGAGGCCCTGCTCTC
GCTGAGTACCAATCCAAACTCCAGAAGCTCGCCTGAGCGGGGCAGCTTCCGTTCCTCAAACCCTGTGACCTCCACCAAAGGATGGACGTCGGCGCGCGAG
CGCTTTTACAGGTCACCGAGCGCAGAGTACGCTCAGCTAGAAGATTGCGGTGTCCTGGGTTGTGCAGACCCACCGACTCGTCGATTCGACGAGGTTTGTC
TTCGCTGGTAGCGAGAAGTGCCCACCCCGGGCCGACCTTGATCTCTTGGCGCTACCAGTCGATTCCCCTACAAGCTATGCCTCTCGGGGAACGACGGCAG
ACATAATCCAGCCCACGCAGGGACTTACCGGAAAGTATACGCTGTTCTTGGACTTAGAAGATTCTGCTCTGTTTTGTTATCTCTGTGTCTTCGGGGAGTC
CCTTCGGGCTTCCCCCTTTTGGTCTCCTATCTGATCCTATACAAATACCTAATGAAATGGAGTCGTTATAGATCTCCCTGCGACTCTTCGCTCAGCTTCC
TAGTTGATCTTCGCCGAGTCGGGTCGTTATGGATCTCGGCCGACCCTTCGCTCCGATTCCTGATTTATCCTCCCAAATGGAATAACTCCCAAATGGAATA
CGCTCGCTGAGTCGCTGAGTCTTGGTGCTCGCCGAGTCCGACCGATTCGCCGAGTTCGCCGCTTAGGTGCGAACTCCGATTAGGTACGACGTACTTAGCT
GGGCCAGAATGGGTGGTCTACCCAAAATATGAGTTTCCCTACACCACAACTGCCCCGGGCGTGATACGAGCCAGGCTGGTAAGTGTCTCGACCATCATTC
AGCTCTCCAATTCTCAACCGTCGGAACTTCGTTCGAAATCTCGTTACCACCAGTCCACGAGCTCGTCGAACACTCCGTCACCTTCTTCCGTCGACCGGGT
GCGTACTGTTGCTTTCGGCGCCACTTGTGCTTGTTCGTGACGTGCTAATACCGCTCTCTTGTGCTTATGGTAGCTTCTCGTTAAATCGCTGCGCTCATCG
CCGATCCTGTTGACGTGTACACTCGCTGTGTCTCGTCCGACTTCGTTGCGGTGGCGTTTGCCTACGTTCGTCTTCTCCGGACCTCTATTGATTCATCGTC
GAGTCTCTTCGCAGCAGATTTTACGTTGGCGATCTTTTCGACGACTCG