Description :
From Genome Similarity Track
Location :
Scaffold_204:1911- 12710
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_204-snap-gene-0.9Callose synthase
Pytar_ATCC12531maker-par_contig_204-fgenesh-gene-0.5Nuclear inhibitor of protein phosphatase-1
Pytar_ATCC12531maker-par_contig_204-snap-gene-0.10Transcription factor E(Y)2
Pytar_ATCC12531maker-par_contig_204-fgenesh-gene-0.2Transmembrane anterior posterior transformation protein 1 homolog
Pytar_ATCC12531maker-par_contig_204-fgenesh-gene-0.6Pumilio RNA binding protein

Sequence
10799 bases(100 bases per row)
AGTCACGCCGCAGCGCACGCACGCCGGGCGCACGCAGCCGCAACTTGAGCCGGTCGCGCGCACGGTCGCAGTCGCACTACACAGTCTTCGAGTCGCCCGC
CGGCGGCGCGCCGTGATCCTAGCGATCTCTCTTGCTTGCTCTTCTGCATTTTCACTTTAGTGATTTCGTGTTTTACTACAATACATATTGGAATTACGCA
CGCATTGACCCTAAACGAGTTAAAATGATGGTGAATTAGAGTTACGCACGGGTTTATGCGTTAATGATGGTTAGAATCCCAATGCACTAGGCGGCAGGCG
TACATGGAACGCGACGAGGTCTCCTTCCTCCATGCACGCAGCTCCAGTCGTCCATCATGAGAGAGAGAGAGGGAGAGAGATCACGGAATTATTACATAGT
CAGTCAAGTGTTCAGCTCGCTACCTCGTGGCTCGCTTTCTTCTGTTCGCTCGCCGTGCTGCTGCTCACGACGCTGCAGCTCTCATTCCGGCCCAGCAACA
TGAGCGGCGGCGGCGACTGGCGCGGCAGCTCTAGTGTGGAGCTCCTGCTCGTGGTCGTGGTCGGCGACGTCTCGCTCGTCTTGGCGATCGTGAGCTTGGG
CAGCGGCAAATCCGTCTCAGGCGCGATCTGCGGCGACGACGACGCCGACGACNNNNNNNNNNNNNNNNNNNNNGGGCGTGACTTCGGGGCTGAAATACGC
GGCGCGCGGCGGAATCGTCTCGGCTGGGCGCTCGCAAAAGTGGACGCGCTTGGAGTTCCCGTCCGAGTCGTCGTCGTCGTCATACACGTCTTGGTTCGAG
AGCTGCTGGGCCGAATTCGGGAGCTGCGCGGCGCTTCCCGTCGCAGGAAGCCCCGCCGATTGCGCGCGCGAGCGTTTCCGCTGGGCTTTACTCGCGCCAT
TGGCACAGGGGAGNNNNNNNNNNGAGCGACGACGCGGCCGTGAGCGCAAAGGCGCCTGTGGTGGAACTGTCCTCCGACTGCGTGCGGCGAATGAGCGCGC
TGACGGACGTCGACGGCTCGATTTGCCGCAGCGGAAAGGGCGCGGCGCCCATGGCATCGTCGCCCTCGGCGTCCACGCCGGCGCGCGGTGTCGCCTGGTG
CGACAGCGGAATGGAAAAGCCGAGGCGGTACGACAGCGCGCGGTTGAGCAGCGTGTTCTGCTCGACCTCGACCTCGTCGGGCGCGAGGCCTATCCGCGAC
TGCACGCGCTCGATAATCATCTCGCGCGACTCGAACGTCTTGAAGGCGTACGTGCGCGACGAGGCGCCAAACTTGAGCGTGGCGCCGTGCACGAGCAGCG
TGGGCTGCAGCGCCACGAGGCGAATGTCGTCGAGGAACGTGCCGTGGCACGAGCCCATGTCCACGAGGTACGCGGCGCCGTCCTCGTGGTGCAGCACGGC
CGCGTGGAGCCGCGACACGGAGCAGTGGTTGAGCACAATGTCGCACGCCACGGCGTTGCGGCCTATTAAGTAGACGGGCTTCTGGTCCACCGTATACTAT
CAAAGATACACACACACGCTTTCCCATGAGCATTCCCCCATATTCATCCTAGAGAGAGGTAGAGAGCCCGTACCGTGGTGAGCAGCTCGTGGTTCTTGAA
CACGTCGAGCAGCGCGATGGCGCGCGGCTTTTGCGGCAGCGTCCAGCTCGGGGCCGTGAAGGGGAAGGTCGGTGGCGCGAGCGGCGCGAGGTATTTCGGT
GTCGCGGGCGTCGCGAGCGTGGCGAACGCGCCGCTGAGGTTGAGCCGCAGCGCCGCGTGCTCCATGACGAGGCGAGTGGGGGCGAGGGCGCGAGATGGCG
AGTGGCGTCGCGAGATGGGGAGGCGCCGATGGGAAAGGGCGTTCGGCGGTCGTGCCGTCGTCTCGGATATGGGGCGTAGTGATGGCGGTTAACTAACCGC
GTTTTCTTTCTCTCGCTCAGCGTCGTCCGCCTGAAGTGTCAGCGTCGCGCCGTCGTAAGCAAGCGCTGACGGGAATGTGCTGACTTTCCGGTCGGCACTG
CAGGAGACTGGGGGAAGGCGGAATGAGGGACTAGGGGTTCCCCCCAAGAAGCCGTTTGCAAACAGACTTTTGACCAATAAAGAGCGGTTGCGGGGGAAAG
GGGTAGGGCGCGGACGACGGCAGAAAAGTCGATTAGGGCAGGGAGAAACGAGAAGAGACAGTGACGGACCTGGTGAGTTCAATGCCAGCTGGGCAAACTG
GTTGGGATTGGTGCTCGAACTGATGCAAGTCATTATGGGAGGTTTTTGACACACACAATGGCTCTAAGCACTCTATTTGTATAGAAGGGTATATCGATTA
TAGCAGGCTTGTTGTTGTCCGGTCGGCGAGCCAGTGGAGTTGCTGCCCACCAAAATAGCCCTTTGTCGTTCGATTGCGATGTGCGAAAATGCGAGGGGTC
AGTGAGACGTTAATCTAGGACACCACCTGTGGGTGTGCCCTAAATGAACGACGCCCCGACCGGCCGTCGGAAAGTCGGAAGCGCCAAGCGTCACTCACGT
ACCGGGAGCAGGCGAAAGCATGGAAGAGTGCGTCCGCCTGCTTTCTCTGTAGAGGGCGGACCAGCGCGCGCCACCCAACCATTGCGTGAGTGGTGCATCC
ATGGCTGACACAGACTCTCGTGTGACAGGACGTTGGCTGATCGCCGGCGCCGTGACGAAGAGGTCAAGCAGCGCATCAGCGAAAAGCTCGCGCAGTCGGG
CGAGCGAGAGAGGCTCAAGGAGCTGCTGCGCCACAAGCTCATCGAGTGCGGATGGCGCGACGAGATGAAGGCGCATTGCAAAGGTACGGCACTGGGAGGG
GATGGGCCGCGAGTGGAGGCATCGCTCATGTGCTCCGCTTCATGTGTGTATCAGAGGTGATCCGCACGAAAGGCATCGACCAGGTGACTGTAGACGACCT
GATTGAGGAGATCACGCCCAAGGCCCGAGGTGCGTTTTCGTCTCCGAGTGGGCGCTGTGTGTCAACGGACCCTCACGCACGATCGTTCGATTGCTCCGCA
GCGGCCGTGCCCGAGAGTATCAAGGGCGACATGCTCGACAAGATCAAGGCGTTTATCGAAAAGTCGGCGTGAGCGAAGTGAATAAATAGACTCGATGCGT
CTGGACGATCCGTCCCCGTCGCTACGTAGCATTGCACCCCGTCAAGAAAGAGACTTTGGCGCACAGGCGTGTGCAGTGTTGTGGACGTGCTCATGGTCGA
CGACTGCCCCAGGGGCGCGTCGAGGGGACGCAAGCCCGAGCCTTTTGGTCCGACGTGTCGTCTCGTGTGCCGCAACATCGAGCGTCGCCTCGTACTTCCC
GCGCAGCACTTCATGGCATCCAGTATTATATCGAACCATGTGACTGTGTGGAAAGATGCCTGCTTGCACCTTGGTGATCCCTTCGAATGGCTACATTCCA
GTTCCTATCATATGTTAGTGTTTGACAGTTAAGAACTCAATTTAACCTCTCCAGCGTCACCGAAATAAAGAAAGTGAGCTCCTCGCATTCCTCCCATCAG
CCCGGCCTTCCTTCCCCACATGGCCGCTGCGAACGGCTCTAGCTCCGGCGCCGCGTCGGCGACGCCCCCGTCGTCCTCGGGGACCAAGCACCGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGC
GCAGAAGAAAGCGGCCGCTGCAGCACTTCAGATCGCGCAATCGCCGTCGCCATCACCGGCGTTCAATTCTAATGGCTCTCGCGAAGCAGCGCGGCCACCA
GCCAAGCCACGCGCGGTCGCAGAGCTGCTCGCGTCCTCGGTGNNNNNNNNNNCGTCTCCGAGTCGCCCGTCCACGCCGCTTCGCCACAGCCGCCTCGCGC
TCGACCTGCCCATCTCGCCGCTCAAGTCGCTGATGAAACCCGCACCGAATCCGAATCCCATTCCGACCGCCATGTCGCCCACGTCCATGCAGCGCATGCA
GCGGATCCACAACCTCCAGATCCAGACCGATCTCTCTCTACCGACACCGTCAGCCTCACCGCCGGCGTCGCCGTCGGCGTCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCGACCGGCCACGGCTTATGAGCCGGGCGGCCCACCCTTCACCGCCACCGCACCACGGCCACCACGCGCCGTTCCGACTCGCAGACTTCCT
CTACAAGGAAGTCTTTGGCGTCCACGACATCAAGTCGAGCGACGCGGTCCACCAGGAGCGCGTGCAGAACTTTCTGGTCGTGCCGTACAACACGGAGCAG
CTCTTTGGCTTTGGCGTCTTTCTCGCGCTCGATAGCTTTCTCTACGTGTTCACGTACCTGCCGCTGCGCATGCTCTTTGCCTGTGGCTGCGCTGTCACGT
CCGTCTCGCTCCACACGCGCATTTTCCACCGCACGCACTTCTACGACCTCATGGTCGCCGTGCTCATCGCCGTCGGCACTAGCGTGCTATGGCAGGTCGA
CATGTCACGCATGTACCACGCGATTCGCGGCCAGGCCATGATCAAGCTCTACGTGCTCTTCACGATGATTGAGATTTTCGATCGACTCTTTTCGTCGTTG
GGACAGGACGTACTGGACTCGCTCTACTTTACGGCACGCTTTCACCCGCGGCGCGTCACCCGCATGGCCATGGACTGTGCCGTCGCGCTGGTCTACGTCG
TGCTCCACGCGCTGCTGCTGTTTGCGCAGGTCGTGACCATTAACGTCGCTATCAACTCGAGCAATTCGTCGCTGCTGACGCTGCTCATCTCCAACAACTT
TGCCGAGCTCAAGGTACGGAACCAGAGGGGTCTGTGGGGCCTGAGTCTCTATCTCCAGTTGCACTGACGATGACTTGTGTGACAGAGCTGCGTGTTTAAG
AAGTTTGAAGAGCAGAATCTGTTCCAGATCGCATGCAGCGACATTGTCGAGCGCTTCAAGCTGCTGCTCATCATTGCGCTCATCATGCTCCAGTCGAACG
CACGCGACGTCGCGTACGGCACGGTACGGTCTCTCATGATCCTCTCGTCGGGTGGTCCCACACCAATCTCATCTATATCCTCCTTCCCTCTATGTAGACC
ATGGTCATGCTGGCCGAGATGCTCATCGACTGGCTCAAGCACGCCTTCATCACGAAATTCAACCAGATCCCTCCGTCGGTCTACTCCAAGTTCATCACGA
TCCTCTGTCGCGACCTCACTGGGTGGAAAAATCAAGACACGATTCTCGACCACACGCACCACGTCTCGAGACGGCTCGGGCTCGTCTCGCTGCCCCTCGC
CTGCGTCGTGCTGCGCATGGTCAGCAAGGCGCTGTACGATCGGTCGCCCATCACGCTCGCCTCGCCCAGCGGCGTGCTCATTACACTGGCGGTGTTTCTG
TGCCTTGCGGCTTTCAAGACGCTGCTGAGTCTCGTGCTCATGATCTACGCGTGCCGATCCGGGCGGCTCGATGACACGAGACCCAAGAGCCCTCGAGCCG
TGCGGCAGCTCGAGTCGATCCAGCGGTACAAATTCTGAGACCCACGAGCCGTGAGTCGACACGAGCTGACGTCGATCGTTTGGATCATCGCGCGAGAACA
AAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAGTCGTGTTTTACGGGTTTGGCTTGCTGTGGCTGGGAACTAAAATCGGCTTA
CTTCCTGTTTGTTCTCTTGTCTGGTCTGTTCTCGCGTTTCTTCTTCTCTTGAGTTCTTGGGTAGTAGTTTTTTTCTTCTTCTTTCTTCATCTTCCTACAA
GCGCCTTTCTCGCCATCGAGGGGATCACTATTTCTTTTCAAAACAAAAATGGGAGGGGTTTCCTGCGTGGTGGTTGGCGGGGGAGAAGAAAGCGTGAGGC
GTGGTTGGCATTCGGTTGGCGGGCGTCTCTCTGCTTGGACATACTGATACAGTTTACTTGTACATCGCATCGTTTGCCGCCCATCCGCTTACATTCACAG
GCGCTCGCTCTTCTTTCCCCCTCGTCTTTCGTCTTCTCTTTACATGCGTCCGCTGCCGCCGCTGCCGTGGAGACCGAGGCCCGAAGTCGACGCAAACGGC
ATGGCGTACGTCGTATCGTAGTGGTGCTGCTGATGCTGCTGCTGGTGCTGAGACTGATGCTGATGGTACTGCGTCTGCATGCCGCCAATGCCACCCATGG
CATAGCTCGCGCCGAGAGCGGCTGGCTCAAAGCCCATCTCCAAGTTTAAATCCATGTGCGGGAACCGCTTGAGGATCCGCGCCGTGATGCGGCGTCCACC
CGAGGTGTTCTTCATGGCCGGCAAGTGCGGACGGATCGCCTTGACGAGCGCGAGGCACTGGTCTTCGGCCGACACGCTGAGTGCGCGCTGCACCACGTAA
TTGGCAAACTGGTCCTGCAGCATCTTCTGCAACTTGGGGCAAATTGTGATTTCGTCCACATACTCGCTGAGCACGGCCGGCGGCGCCTTTTCGAGACACT
TTTCAATCACGTTCGAGCTGAATTTCTGGACCGACAGTTCATAGACATTGCCCAATGGCTTGACAATCACGCCATAGGCCTCGTCAGCCGTGCACGAGTC
GAGCACGTACTGGACCACGTAGTTGCCGTACGGATCTTGCATGAGCTTCATGGCCTGCTTCTCCACTTGGGCAATCACCTCGCGCTTTTGCTGGTCATTG
GCCGCGTCCAGACAGCGCTGCAGCACGCAGCAGCCATGACGATGGGTGCCCACAGTCGTGCACTCTTTGCAGACCGCGTCAAACACAAACTGGTTGTACT
CGGGCTTCATAAACTGGAGTGCGCGCTGGATCACGTGGTTGCCGTTCGAGTCGATGCAGAGTCGGACGGCATCATCCTTCAGCGCGTCGACAATGAGGTC
GGGCAGATTCACGCGCCGCAGTTCGCTGCCGTCGCTTGCAAGTTCGACGACCTGGGCCGACGTCGCACACACTTCCACGACTTTCTGGACCGATCGCGTG
CCATGCAAGTTGAGCGCCGCCGCAACCAAGTGGCTTCCCACACGGCGTACCATCTCCAATCGCTGCAATGGTCGCGCGCGCTCGAGCAGCTTCTGGAAGA
GGTAGTTGCCAAACGGATCGACCATCATCTCGGCCAAGTGGTCCATGGCTTCGCCATAAATCACATCACACAATGCCTTGCGCTCGTCATAGTACTCGAG
TTGCTCCTGCAGCAAGCGACAACCATTCTGGTCCTTGGACATGGAAAACACGCGGCCCTGGACGTCCTCGAGCTGGAGCAAAGCGTCGACCACGCCAGGC
ACGGGGGCGGACTGCGACACAGCCATCGCGAGGCTGCTGCCGGGGAGAGTCGCCATCGCGTGGTGCGGGGAGCCATGCGGCGCCATCGCAAGACCTTGAA
GTTGACCCGAGGAGGACACGTGGTGCAGGTGATGATGGTGCACATCGTTGCCGACACTGCCGCTCCCCATACGGTACGTCGATCGACTCGAGCTACCACC
ACGCGTCGGCATGTAGGACGATGACGAAGTCGACGGCATGTACGCGTCATACTCGTGGTGGTGGGCCAAGTGGTGTGGCGACGTCGCCGGTGACGAGTGA
GGCACGTGGAACGACTGCGATTGGTGGAGCTGTGGCTGCGGAGGCGGTGGCTGCTGGTGGTACGCAGAGTGGTGGTGCTGGTGCGAAGGCGGTGGCTGGT
GGTGCGCAAACTTGCACTTGTTGCCCATGCGGCAGTGACCCTGCAGATAGAACTTGCACTGCTTGACGCCCCCATAGTGGCCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCCATCGACGTGTGGGGCGACGGCGGCGGCGACGACTCCATCATCATCATACGCCCA
CCACTGGACGAGGACGACATCGAGTACATGGACTGGGAACGTCCAAGGCCGCGTTGAGTCGGCGCGCGGTGGCCATGGGACTGCTGCAGCTGACCGTGGT
GGCTATGGTGGTAGCCCTGTTGGACCTGCTGGGGTGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCGGCGCAAAACCCGCGGGCACACTCGTGTTCAACGTGGACTGGATCACGTACGGCGACTGCGCCGGTGCACCTCCGTAGGCTCCCTGCGAGAC
GCTGGCTGTCCCCCACGATGAGTGNNNNNNNNNNTGCGCGTGCTGCGGTTGCTGAGGACGTCCCGAGCCTCCTCCGTAGGCGTCGCTGGCGTACCGATAG
CTGCTGCTGCTGTTCGCGCCCGTGGAACCGTATCCATAGGCCGCCGTTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGAAGCTGC
GACTGGTGGAGAGCTGCCTGCGATTCGGCATAATAGTACGCAGCTGAGCTCGACGCACTACCCCCACCTCCCAGCATCTCCTGGCTGCTGGTCGACGACC
ACTCGTCGTCCGTGTCCACTGCCGGGGGACTGTGGCTCAGCATGTACCCACCATACGATGCTGAAGTCGCCGTAGGCCCCATGGCCGACGCGGCGGCAGA
CACCGCTGTTGGTTCTTTGCCTCCTCCACGAGCGCGATCGCCGGCGTCCATTTCGAGCGGCTGCGACGGCGGCGGGTGGATCGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNACGCTGGCGTTGGAAACATTGGCTTTGTTGGCGTTGGCGCTGGCATTGCTGGACACGTCGTGGCGCCGCGGTGGCAGGCG
GTGGTGCGACGGCACCGGGGGTGGCGGATGGTCATCGTCCAGCGCCATCTTGAGGAAACCGCCTCCAAGCGCCTGGCTCGGCGACTGCGAGAGGAACATC
TCGATGCTGTTCTTGCGGCGGCCGCCACCGCCCAGCGACACGGACCGTGGCAGCGGCGGCGCCACAACGCCCACCACCGTGGTCTTGGCGTTGGAAACGC
TGGAAGTGTTGGCACTGCTGGCGTCGTGGGTCGTCTGATTCGTTGGCGACAGCGTGCGCGGCGGCAGCACCTCATTATTGTCGCCGTGGTCGTCGCCAAA
CTCGGGGGACGCGGCGCCCGAGAAAAAGTCGCCGTCGCTGCGCGCGCCAAAGTCAGAAAAGCGGAAAAACTTGGATTCAAAGCCCGAGGGTCCTCCTCCG
TTGCCGCCACTGGGGACGACTGTAGCGGACGTCGTGGCGCTGGAGGAGGACGGAAGAGCGGACGTTCCACCCACGGGCAATTCGCTGTCGTCCTCGTAGA
CCGTCGACGAGAGCGACGAGGCCGAGTCGATGGAGCGCAGGCGTGCGTCCCGCGCACTGTCGTCGCGCTTGGTCGTCGCGCCACTGGCGGCAATGCTCGA
GGTCGTCATCTTGGTCGAGGACGACGGGAGCGGAGCCGCAAGCGGAGGAAGAGGAGGAGCAGGAGGAGGGATCTCAGCGGCGCCAAATTCCATCAATACG
CCGCCGCTACTACCGCGCATTCGGGATGGGGTTGCGATCGGGAGGTTCTCTCACTCTCCTAGCGGACGACAGGAAAGGAGGAGAGGAGGAGGAGGAGCGG
AGAATTGCCGAATGGGAGGAACCCCGAGCTTCTCTGTGGTGGCTGCGTCCTGTCGCGGGCGGAATTCCTCGGCGTGCACGCGGAAAGAAGCGCAGAACGC
GACGAGGCGGAGAGGAGAAGAGCGGAGCGGAGAGCGAGTGGGGAGCACGCACCACGCCAAGCAAACCCACACACAGACACACACGGCGGGAAGAGAGTGG
AGGTCCCTTCACTACGAGGGAGGCTGGAGGAGCGGAGGGGGAGGGGAGCGTCCTCTGCGCAACGCTGCAGCGACCGGCGATACCGACGGGCGGCGGCGGC
AACGAGGGACTTGAGTTGCGAGGGGGGCGAAGTACTGGGCGTGGCGGCAACCTCCTAACTCACTTGGACAATGTATGGTCTCCTGCTAAGTACGAAACCC
TGTCCAAAGCCGTATGCGTATACAGAGGTTCTGACGTTGAAAACCACAAAAACAGGCACCATCAGAGGCACCAACGTTCTTTTTCTCGTGGATAAGTCCG
CCGTGCTAGACCTTGAAAAGGGTGGTGTCCTCAACTTGGTCCCCCCAGGGGCAGGGCGAGCAGAGACAGTCAGTCCTTTGGATATCGTACCGTACTAATA
CAGAGTACGGACATGTGCAATAGGGCCTGAAGCCTGTAGGAGGGGAGGGGGGGGAGGGGAGGGAACAGTAGCTTTCGAGTGGAGGGGAGAAGAAAGAGGA
CCAAACAGTCGGGGAAAGTCAGTGGAGGAAACTGCGGGGGTAAGACGAGACAATACGGAAGAACGGGAGCCAGTGATGGCTGATGGCTGTGCCACTAATG
TCACTATAGAGAGGTGACATGCGCACATGTTCCTAACTTTGAATGTTTGTATCTCTCCGTGCGGAATGATGGTGAACCCATTGGTCTATCGGATACTGTA
TCCATTTTTGGAACGAAACGATCCGCAACCGCCCGTTTCTCCTCGTGCATCCGCGAGGAGATCAGGAGAAAGCAAGTGCTTCGTGCACGATCATGCTTGA
AGCCACAGCACTTGACGCCACCGAAATTGCCGCTCCTCAGGCTCTGGGCTGTCCGGATGCTCTGAACTCTCTGAAAAATCCTGAGGACCGGGAAGTTGTT
GATGCTGAAACTCCACCAAAGAGTCTCCCAGCCAAGACCGTTCTGCCGTCTCTCGACAAGCCGCCATTGGACCCACGTGTGTTGCGCAACGTGCTCACG