Description :
From Genome Similarity Track
Location :
Scaffold_45:19108- 20635
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012871Similar to PKHD1L1: Fibrocystin-L (Homo sapiens)

Sequence
1527 bases(100 bases per row)
AATTGCGAATTTGTGTCAATGATATCGACTGCACGACTTCGTTCGTCTGGTTTGAGTACCGGCTGTTCCCAGTAATCCGAGAGCTGGTGCCGAGATTCGG
GTATCAATCTGAAAACACTGTGGTGAAGGTAATCGGATATGGCCTTTTCAACGCCTCGTCCATCATGTGCAAATTTGGTGACGTTACACTTATGCCAGGC
AAGTTTCTTGACGAAACTCAAGTCGAGTGTGGGATACCAAAGCTCACTCGCGGCTGCAAGCGCTTCGAACTGGTCATTGATAGTCAAGTCCAGTCGGCAT
CGAGTGGCCTTGAGTACTGCTTCGCACCGAGGCTTTTCATTCACTCCATAGTTCCAACGAACGGCCCTACGAAAGGAGGAACGCGTGCACTCATCAACGG
TGGCTTATTCGAGCTTACTAAGAGGTACCTTTGTGCGTTTGGATCCGTTGAAGTCGCTGCGGAGTATCTTTCAGAATCCCAACTGGTTTGTGTGTCACCG
CCAAGCGCGTTGCGGACCGTTGGGGTTTCCATCCGAGAGTCACAAATGTCAGCGAATACCAAGTTCACACTATCCTTCCGATACATGCCCATGCCCGTCG
TGACTTCGATTAGTCCTCGGCAAGGATCGGAGTCTGGTGAATACCAGCTACTGGTGACCGGGAGAAATTTTGTTCGTAGCTCGGCTCTGCGCTGTCGATT
CGGTGTATCTGACGTCGTGGCAGCCGAGTGGATCTCTGAACAAACTCTTCTTTGCATGGTACCGCAGCATAGTCCCGGGCTTGTGAACGTGTACGTAACG
AGCAACTTTCAGGATTATTCGGAAAGTTTGGGTGTGTTTGAATTTGTACCAAGTCCACTCGTACTCACGTTTACACCCACGATAACCACCAACGCCACCA
ACTTGACGCTGACGCTCTATGGACGTGAATTCAGAAACTCGACAGGTCTTCGATGCGCTGTTGGAGACGATTTGACTCGCGCAACGTATGTGTCCAACTC
CGAGATTGCTTGCGTGATTCGACAGCTGACGCGAACGCGTGTGCCAATTGGTGTGGTTGATCTTTCGGTTGCAATGAGCGCTGTGTTTGCCCCAAGTGAA
TTGGAAGTAATGGCACCAACCGAGACGAACCGGTGGATGCGACCGCGGTTCGGCTCTGAGTCGGGCGGGACACCGTTAGAGATTAGAGGGATCTCTTCCT
ATGCTCTCGTTGCAGAAAACAAAGCCTTCTGTAAATTTTGTGTTATGGCTCGCATGTGCTCCGACGTGTCACCCGCCCAGTATGATTCTGGCTTACTTCG
ATGTTTATCTCCGGAATGGACCGGTCCTCAGCTACAAGGCGTGATGGGCGTTTACTTGCTTACAGACGCTGGCAGTAATTCCCTGTTAGCATCATTTCCG
TATCGCTACCACAAGGAAGTCTTGCTTGAGCAAGCATCTCCAAGCGTCGGGTCCGTTCGTGGTGGAACAACTGTGACCATCTTCGGATCGAACTTTCAAC
CAACCGAAGCGTTGAGCTGCGTTCTAG