Description :
From Genome Similarity Track
Location :
contig_15:19107- 20453
Transcript NameFunction/comments
g3341.t1hypothetical protein

Sequence
1346 bases(100 bases per row)
TACGGGACACGTGGGTATGTGGTGTTGTGATTCACAAAAACTTCGTTAGTGCGGCTTCCACGCAACAACACAACAATTCGCCGAGTCAGGTCGGCGTTGT
TGGGCTTGCGCAGGGTTCTGTTGGTTCCCTTTGCGGTTCGGCCCAGCCGGGTCCAGTTGAGGCCCTGCTCTCGCTGAGTACCAATCCAAACTCCAGAAGC
TCGCCTGAGCGGGGCAGCTTCCGTTCCTCAAACCCTGTGACCTCCACCAAAGGATGGACGTCGGCGCGCGAGCGCTTTTACAGGTCACCGAGCGCAGAGT
ACGCTCAGCTAGAAGATTGCGGTGTCCTGGGTTGTGCAGACCCACCGACTCGTCGATTCGACGAGGTTTGTCTTCGTTGGTAGCGAGAAGTGCCCACCCC
GGGCCGACCTTGATCTCTTGGCGCTACCAGTCGATTCCCCTACAAGCTATGCCTCTCGGGGAACGACGGCAGACATAATCCAGCCCACGCAGGGACTTAC
CGGAAAGTATACGCTGTTCTTGGACTTAGAAGATTCTGCTCTGTTTTGTTATCTCTGTGTCTTCGGGGAGTCCCTTCGGGCTCCCCCTTTGGTCTCCTAT
CGATCCTATACAAATACCTAGTGAAATGGATCGTTATAGATCTCCCTGCGACTCTTCGCTCAGCTTCCTAGTTGATCTTCGCCGAGTCGGGTCGCTATGG
ATCTCGGCCGACCCTTCGCTCCGATTCTGATTTATCCTCTCCCAAATGGAATAACTCCCAAATGGAATACGCTCGCTGAGTCGCTGAGTCTTGGTGCTCG
CCGAGTCCGACCGATTCGCCGAGTTCGCCGCTTAGGTGCGAACTCCGATTAGGTACGACGTACTTAGCTGGGCCAGAATGGGTGGTCTACCCAAAATATG
AGTTTCCCTACACCACAACTGCCCCGGGCGTGATACGAGCCAGGCTGGTAAGTGTCTCGACCATCATTCAGCTCTCCAATTCTCAACCGTCGGAACTTCG
TTCGAAATCTCGTTACCACCAGTCCACGAGCTCGTCGAACACTCCGTCACCTTCTTCCGTCGACCGGGTGCGTACTGTTGCTTTCGGCGCCACTTGTGCT
TGTTCGTGACGTGCTAATACCGCTCTCTTGTGCTTATGGTAGCTTCTCGTTAAATCGCTGCGCTCATCGCCGATCCTGTTGACGTGTACACTCGCTGTGT
CTCGTCCGACTTCGTTGCGGTGGCGTTTGCCTACGTTCGTCTTCTCCGGACCTCTATTGATTCATCGTCGAGTCTCTTCGCAGCAGATTTTACGTTGGCG
ATCTTTTCGACGACTCGCTAGCATGGTGCATTCGCCGAGCCGTGCT