Description :
From Genome Similarity Track
Location :
Scaffold_130:191065- 194873
Sequence
3808 bases(100 bases per row)
AGTAATAGTCTCTTTTAGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCTTGGACTACTGTAGGCACCTATTTCTCGCCCCGAGTCACCC
ACCATTTCTCCTGTTTCACCCACTTCAACCGATCTGGCAGTTCCCAGGTCTCTCCGGGCTCGATCCAGGTCGTCTTATCCGCCCTTATGATCCTCATCTT
CGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCTGCCAGATCCAACCTCACTCCGGCTGGTACC
ATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCAAACCAGTACACCAAACAACCTGCCAGCGTGATATTGATCCGCG
TTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTTATGAGCAAAGGCGGTAC
CCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGC
ATGGTACTTCCAGTATCCACGGGACTCCCCTGTCAGCAGATCCATGGATCCACCATCTTCAGATCCCCGGGATCCAGTAACCTGACAAACCTTGGGTGGA
TCTGCAGTGACCTCACCCTTGGTAGGCTCAACCCATCGACCATGTTGTCGCGTCTCCCAGTAACCGCGCGCTTCTCCCCTTTGTAGATCCAGGGTTGAAG
AGACTTCGGATCTGGCAAATTCATCCACTTGGCGCAAACTAGTAATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGT
TCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTATTGGATTCAAACCCGGCGAGCGTCCTAGT
TTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCC
GACGTCGTGACTCTCGCCACACCCGCGACACACGTAGGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCA
TCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCACGGGT
ACAGTATCCCCCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAAC
CGTCGGATCCTGACTCAGTTCCTGAGTCGGGGCGCCGTGACTTGGTGGACACGTCCAGCTGGGGGCCGGAGGCGTCGGAGCCTTTTGACCATAGTTAGCG
GATGCGGCCGCCGCCTTATTCTGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGGCTGATCCTCGGCGACGACACTAGATCCATAGTGCGCGACCTTTCTCCCGGTGATGGACTTAACTCTGGCAAAGAGGTC
CCGCGTCGCGGATACTATGAGATTCAAGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTGAGCAAACGTAATATA
TCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGCCGTGGATTCAGGATCCGCATGACAGGAT
CTTGATGCAGAAAATCGCGTAGCGCTTGGTAGTGATATACGAAATCGAGATCCTTGTCTAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGCGTCGCCT
TACTCGTGTTGGCCTTATTTCTCGTCTTTTCGACTAGCGGGTTTGGGTTTAGGTACGATGTTGGTTTAACCGGTGAGTCTGCAAATGCATACCGTTTCGC
CTTCACTTTACCTTGTTTTGTTAGCGGATCTTGACTTGCGCCAAGATCCGCAGGGGTCCCCGAAGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGA
TCCGGATCCACCTCTCTTCCGTCGACACAGTTTTTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCAATCCGACCTCCG
ACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCATGCGCACCATTGT
GGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCGGATCCAGCTTACCAAATGCACCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTT
CTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGCGTCTTGG
CGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCAGG
GCCTAGATCGTGGATCTGGCCGTAGAGTTGCCTTCGGGTGTGTTCCCATGCCTTTGTGTTTCCTTGGCGTTGTACTTGCCGCCTCCTGTGACGGGATCTT
GAGAGCTG