Description :
From Genome Similarity Track
Location :
Scaffold_301:191- 2060
Sequence
1869 bases(100 bases per row)
ATCCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTGCAAGAACATGAGGGGATCT
GTCATCCAGTCACCTTTGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTTGCGCTCCTGCGCGTGTTGGATCT
AAATTATAACCTGCTAGTGGGGAGATCCATCCGGATCCTGACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTGCAAGGACGTTTGGGA
CAGTGGGCAGCTTTACTCTCGCCTTGGACGCTGGAAATTGTGAAATGTTCGAAAGGGGAAGATGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTC
GAGCTAAGATGGATGAGGCACTGACTAAGATCGCCCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGTGGATGAGGATCT
ATACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGAGGAGCATACAGCGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCC
AGATCCACTTATGCGGAGGGCCTCACCGTCAATGAGGCGGCGTATAACGGGCTCCTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCAAAACGGCTGG
TGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCA
CCTGCGTGGTTTGTTTGGATACCAGAAACTCGAGTGGGTAACAGTTCCAAACCAGAATGGGAATGTCCCGTTCGGAAAATTTTTGCCCGTTGTCCGCTCT
TTAGGCATCTCATGTGGTGTTTCCAAATGGAGGGAGAAGCCGAACATCAGGATCTCGTTACGTTGAACCTGACTTGACGAAGTGGTAGTGGTTGGATCCG
GGAAAAAGACAGTCCAGGTGATGGCTGTCATTAGATCCAGAGAAAAGATTGGATCCAGCCCCCCGATCCTCGAGGAAACATTCGTGAAGAGAGTTCGCAT
CGAGCGGATCCTCAAAGCACAGAATGAGGAAGCGTGGATCCTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACTTAAGTCGGGAGGATGCCAAA
TCCTACAGCGTTATCGCTACGGATTACGCGGTGGATCTGAACGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCCACGAGGATCGGGATGGATTGA
TGAGATTGGTGATGCCAGAAACCTTGCAACAGGATGTCCTACACCACTAACCACGCTAGCTTGGAAGGGCGGACATCAGGGCATTGGTCGGATCTACTCA
ACGGATCCCGGAATGTTTCCATTGGAGAGGACTATTCAAGGAGTGTACAACGATATGTCGGTGAAATGCGTGGATTGTGAGACAGGCAAAGGCAGATCTA
CGATCGAAGGGGAGTCACCTGGGAATGTCCGAGCGACTTACCCTTTCCAGATCATAGCCATGGATCATATTCCCTCGTTGCCCAAGTCGTTCAAAGGAAA
CACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATATGTGATTGCCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGCGGAATCGTACGAGGAG
TGTGTTTTCCGAAGATTTGGTGCTAGCGAAATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTAGGGC
AGCGACAGCGAGCAACCATGGCGTATCGTCCCCAAGCTAACGGGTCGGCCGAAAGCATGTCGTCAACAT