Description :
From Genome Similarity Track
Location :
Scaffold_50:191- 1919
Sequence
1728 bases(100 bases per row)
CCCCCGATTCTCGAGGAAACATTTGTGAAGGGAGTACGCATCGAGCGGATCCTCAAAGCACATAACGAGGAAGCGTGGATCTTAGGACTAAAGAAGTATC
TGATGGGGGATGTACGAGACCTGAGCTCGGAGGATACCAAATCCTACAGTATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTATTGCCC
CCCCTACGAAGAGAGTCAACGGGGATCGGGATGGATTGATGAGATTGGTGATGCCGGAAACCTTGCAACATGATGTCCTACACCACTATCACGCTAGTTT
AGAAGGTGGACACCAGGGAATTGGTCGGACCTACCAGCGGATCCGGGAATGTTTCCACTGGAGGGGACTATTCAAGAGCGTACAACAATATGTCGGTGAA
TGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCGCCTGGGAATGTCCAAGCGACTGACCCTTTCCAAATCATAGCCATGGATC
ATATCCCCTCGTTGCCCAAGTCGTTCAAAGGGAACACAGAATTGTTGATTTGGGTAGATCTGTTTACCGGATACGTGATAGCCAAAGCTAGTGCGTCTAG
AACCGCAAAAATCATTGCTGAATCGTACGAGGAGTGCGTTTTCCAAAGATTTGGTGCTAGGGAGATGATTAGACATGATCGGGATCCAGGCTTTATGTCG
GATTTCTTTCGAGCTTTCAACCGGATCCTGGGGCAGAGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTGCAGA
CGATCACGAGGGCACTCAAGATGTATGTCTAGTATTTGGATCAGAGGGATTGGGATGAGCACGCAGAACGACTCCCCTTCGCGATGAATACCGCCCAAGA
CAGGATCCGGGGTGATACTCCATTCTACTTGGTACATGGGTGGGATCCCAAATTCACCCTCGAAGCGGCCATTCCAGTATGTAGCACCAAGAAGAGAAAC
CGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCCAGATCCCAAGTGAACGAACGGCTGCGGAGTGCGATACAGGATCGAGCGG
ATCGACACAACGAAGACGCCCGTCCGCATAAAATCCATTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTAAAAGAAGGGTACACCAGCAAATTGGCC
CATCTATGGCATGGACCGTTCCGGGTGAGCGAAAAGATAGGAGAACATGCGGTAAAGCTGGAAACGGCATTTACCGAATATCGCCTGTTCCCTGTAGTAC
ACGTATCCAAGCTGAAATTGGTCAAAGAATATCCAGATCGGCCGCAAACCCGTCTTTCGGTAGATGGATCCGACCGGGTAGACTTCGACGAAGTCCTCCT
ACTGGAAGATAGTTGGAATGTGGACCTCGAGGCCGACGAGTTCGAAGTCGAGAAGATCACCGACATGAGGCCAGGGAAGCGAACTAGATACGGACGGATT
TGCCGTGAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCATATCTTAGCTGTGGAGCATTACTCTATGATTTCTTGCGGG
ATCGTACGAATCGTAACCGATTCGGCGTGATGCAGGCTCATGAAGAAGAGTAGGAAGGGGGATCCATGGATGTGAGTTGGTCATGTCGATGGGAGGATGA
AGGAGGGGGTGTGGGCCAGGAGGAAAAG