Description :
From Genome Similarity Track
Location :
Scaffold_2253:191- 1696
Sequence
1505 bases(100 bases per row)
CCTTCACGCGCTGCACCTTCAGGTGCCACTGCGATAGCAGCACTGCGAACTCGACTGCACGTCCGAAAAGAGACTTCGCCTTATGTACCCACTCTAACGT
CGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACATAACAGATATTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCGGCAGGATGG
TAGTTCATCTCGGACTCCTTGAGCACACGTCCGAGGAAGCGTACGGGGTGTAACTTACCTTCATGTTCCTGCATTAGCGTAGTGCTCAACGCCCATTCAT
TCGCAAAGAGCATGACGTGAACTTCTTTCGACCAATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATTTTTTGAAGGAACGACGTGC
CACAGAAAGGTCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGATGTAGTAATTA
ACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTCGGAAACGAAAGCTCGGTGATGGCGGCAAGCTTCTTGGGGTCAGCCCTGATACCTTCTGGCG
AATTTTTATGCGACGAAAGTCGACCTTGGGCTGGCTGATTGAGCTCTTGGTGAGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCTA
GCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGAACGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGGCTC
CCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAAC
GAACCCTCGGCGCTTGGTCCACGACGTTCCTTGACCTGTTCTTCAGCTAAACGCATCCTCTCCGAGTATTCAAACCAACCTCCTCTAGGTTGAACGATGC
GTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCTTTAATCCAAAGGGCATGCGCAACCACTCGAAGTGTCCGAGTGCGCAGACAAACGCCGATACT
TTACGTGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGA
CTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCAC
GATCGGCGATGCCCATGGACTATCTGAAAAGATGATCAGTCCTGCTCGCAACAAAGCGCGCAGCAGCTCGTATAGTTTGCCGAGAAATCGTAGCGGCACG
CGCCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCGCCGTAGGCTGGCGGCGGCAGTGTGTTACCACTAGCAACCAGGA
TCTGT