Description :
From Genome Similarity Track
Location :
Scaffold_604:1909- 4143
Transcript NameFunction/comments
Phyke_g10414hypothetical protein PHYSODRAFT_304534
Phyke_g10415conserved hypothetical protein

Sequence
2234 bases(100 bases per row)
ACATTTTGAAGTCCACGCGCGATAAGAGCAGCATTGGGTGATGAGATCGCTGGAGTGATGATACAAATCACTCAAGTCCAGTTTGAGCAAGCACTCAAGA
TTGGCAGCCACTCCGTAACCTCgtgccgtcgctgtcgtcgtcggtCTTATTCAGGTCCACCCTGTTGTCTCGCTGTACGCCACCGGTTTCGGTTGACGTT
GCGCGACGCTCGAAATGATGCCCTACACCTACACAAAGCACTGTTCGTTGCTTCCGGCGCGTGGCAAAACACCGTCTGGCTCTAGCATTTCACCGTTCTT
TCTGTCAGACCAGCATGAATTTGCCTTCCGTTTCCTCTGAACGTCTCTCTGAAAATCAAGTCATTTGAAATCTCTGTAAAGCGTAGGTATGCACCAGAGG
TAATGACCGCCATCTCTCCTCCAGTGGTCTCCTCactccccccccccccttttTTCCACTCTAGTTTAATCCCCCTTTTTGCCGACAAATCAAAAGTCGT
CTCTGtatacaaattccaagtgaaGGAATCAGTTGAAAAAAAAGCTGAATCAAAGCGCCCCTTTGTATCTTCGTTCATTCCTCAATCTGCCTTCAAGACC
GCAGGCAACACAACGCAATAGTAACAACAAATTATACAATGAGCTCGAACGGAAGCACCGGCACGTCGTCCGGAAAAATGGACTACGGAAGTACCAGCTA
CAGCGACGTCATGGTAGACGTCAAGAAGGCTTACAACAGCGGAGACCATGAAACATCGCGtctgctgcaccaactcAAGGCCGACATGGGGAACCACAGT
CACGCCCAGGAAAACCACATGACTGGGGGAGAGCACATCAAGAGTGGCGTCTACGGAGGTCTCGACGgcatcatcaccaccttcgcCACGGTCACGTCGG
TGGCTGGATCGGGTCTGCCGCACTccgtcatcctcatcatcggTCTGGCCCATCTCGTGGCTGATGGACTCAGTATGGGACTCGGAGATATGCTCAGCAG
TCAGGCAGAAGCAGATCTGTCCAACCACGAGCGCAGCAGAGAGACGTGGGAGTTTGAGAACTACCCAGAGGGGGAGATTGAAGAGATGGTGGAGCTCTAT
GAGAAGAAAGGAATCTCTACAGATGACGCACTTCTGGTGGTCCACACGTTGGCCAAGTACAAAGAAGCATTCATTGACATTATGATGATTGAGGAGCTCA
ATCTCATGCcggtggacgatgatgactCGCCACTGACGGGCGGCATCATCACCTTTGTGTCCTTCATGCTGTTCGGCGTCATCCCGTTGCTCTCATACCT
GTTTAACCTCATCCCGGGCGTCAACATGAGCCCCGAAACGACATTGTATGTGTCGTGCTTCCTTACGGTCAtcacgctcttcttgctgggTGCAGTGAAG
GGAAACTTTGTAGGACAAAAGTGGTGGGCATCTGGTACCTCCATGGCTATCAATGGATCTATTGCGGCGGCTTGCGGATGGGTCATCGGCTACTTGTTGC
AACTCACAGGTATCCAGAACATTGGATAAATTGTCAGCGCGTGGGGAAAAATGACACAGGGTTTTTGCATCGGATGTTGCATTTGACGCAGCCGTATCAA
GACATCGtccgagaagaagagctgaCCGCTTTGTAGCAGTTGTATTATCGGCTTCTTTATATTGTCATGTTGATACATGCTTTTGTTTTTACCTTTGTGC
GTGTGTTTTTAGTCGCTTGTGCGGATGGGCGCAACACTAATTTACTGCCTCTACATGCCTTGATTGAGACTGCCTGTTTACACTTACCTAACAGTAGAGA
GCTATCTTTTGTATGTCAAAGACCTTCGACAAAGCCAGTCATGGCGCGAATAACGTCCAGACATGAGACTTCGAACTGCATGCTGATCACGAATAGCACG
GCGAATACCATGAAAGCCATGGTGAACAGCATGGTCCAAGGCGCAATGGGTTTAAGTACAGCTGAAAACGGAGTGTCGAGATCAAAGAGTGAAGGCCGAA
GCGCCGAGCTGAGAATCATAAAGTTGTGCAGACAGCCATTGTGTGCGCTGACGCTCAAGATGCGCCCGTCGGGTGTCCACTGCAGGTCTTCAAAGCACAG
CGATGGCGCTTGCATCGAGCCGCTACCCGAACTCACAGGTCCCGAAAGATCTGCAAGCATAGATGACGATGTTGGAGGCGACCCTACTCCTGTTGAAGAG
GTGGCAGAgactgaagacgatgaagaggacggGG