Description :
From Genome Similarity Track
Location :
Scaffold_72:190850- 195284
Transcript NameFunction/comments
g13638.t1hypothetical protein

Sequence
4434 bases(100 bases per row)
TGAGACGAACGCTTTGATACCCGCGCTTCAGTGGGCTGTACCAGATGCTCAGCGCGGCGGTAACGGGCCGAAAGAATCAATTGCGGTGCTGGAGACGCCA
CAGATCAATTTTTGCGCTGGAAAGACGAGGATCGGAGCGATATAACGCGGCTCGCTTTCGACTAAATCTTGCTAACGATAGCACGCGCGAAGTGACAATG
CTCACCGAAAATTGGTCTGTCTCAACGCAGTTATCGGGGAGACGAGCCTTGACACTGCATATAGAAATACTACAACGTGTACACTAGTTTTTGCCATTGT
CTTCCGCCTTCGAATACGAAAATGCACCCGCTCGGCATGAAAATGCAAACCGAGCCAGCTGGCTGACGTTGGTGGCGACTTGGCCATCTGTGTGCGTGTA
GGGCAAGTCACATGGTGCGACTCCGCCATGTGCAAAGCGCGTGGATGAATGGTGGCGAGGGGATCACAAGAGTCAGCAAAACTCGCATCCTCTTCCGTCG
CATTTCTTGCGCGGCATCCGAGAGCGAGACAGCGTCAGAGAGAGGCGTCTGAACACGGTACTCGATTTGCCGCTCTTGAGATCACGGCACTTTTGGATTT
TGCTGGACGGTGGCAAGGCATCGTGCACGGATCGGAGGCGTTTGACAGCGCGAGAGTAGACGCTCCTTGCATGTCGAGGCAATCGGCCAAAAGCATGCCA
GAAAGCATCAACAAGCGACAGCTCAACATCTCAACGGGCGATAAAGAGTGCGTGATTCTTGTCTTTGTTGGCCTGGCGTTCTATCGTCGCGTAGGTCGTG
AATTAATACCCGTCTTCATTTTGCTTCTAGGATTACCGTGGTCCCGTTGAACGATGAGGGCTACGACGAAATGGCCAGCCCTCCTCATGTGCGTCTTCGC
ACGGGCACCATCGGCAGCGAGGACTTTAACGACAAAGGCGCCAATCTGCACATCGATGTCGACAAGAACCAGAAAAAGTCGACGAAGGCGAACATGTTTT
CGTGTGAGTGCCGATACTTGCTCTCAATTCGTAGAGCCGCCTCTAATTGGTACGCTTGATGCTTCAACAGCCGAGTTCCGTTTCAACGCCGAGCTTTCGC
TCCGAGTTGCCTGCGGTGTGATCATCGCCTCGTTCATCCAGACGCGTGACCCGGACTACGATCCATCCATGGAGCACGACAAGAAGTGGTTCTTCTTCCC
CGAATGGTACTATCTGGGCGGTCTCAGCTACTGTGCTGTGGCTGTCATCTTCTCCGCGGGCAAAAACGTCGGTGCGACGCTGACTCAAGTCTGCCAGGCG
TTTTACGGTGTGGGTATGGCGCTTGTGTACAACCTCCTGCTCTTCTCGTTCGTTGATGTGCGCACGTTCAATGAGTCGTATGATGGCTATGTCTTGATCT
CGAAAAAAATGTCGTTCGGCTCGAATGACTACTACGTCAACTCGCACAACTTCTACGCTGTGCTGCCGTGGATGGTGATCTTCACCGTCGTCATTCTACT
GCTGCCGCTGGAGAGCAACACCAAGAAGTTCGCGTTGGCCAACAACCTTTACTTCAGTATGTTGATCATGTGTTGGATCACGGATTCGAGTTTCGCCTAA
CGAAATATTATTTTGTGGTCTGTAGCGCTGACAATCATCAACCCCACGGATCCGCTAGACTCGACGAAGCTTAAGGAAACCAACGACAGCTACTTCCAGA
CCAGCAACATCCTGAACAACCTGGCGATGTATTTCCTTGTGGGCTTTGTCGGCACTCTCATTTCGCTTCTCATCATGTTTATCCCGTACCCAATCTTGTA
AGTACTATTTTCATCTCGGATGTATTGTCATTTTTTGCTAACCTGTATTTTGCGTTGTTTCGCACAGTGCCATCGCTAAACTGCGTGATGAAACAAAGAA
CGCGTCGGGGGATGTTTTGGATCTGCTCAATGTCATTGTGGACTCGTACTGCTTCAAGAACAAGAATGTGGATCACATGAATTTCCTGAAGCTCAAGCTT
CAGCGTAAGTTTGATGCGGCGTTGGCGCGCCACCGGAGGATGATTGCGTTGCTGGATAACGTGTGGTGGGAGCAGCTTTTCGGCTTTCACTTCTTCTTCA
AATTCAATCGCTCAGTCACGAAAGGCTACGTTCGTCTTATTGGATCGCTGATTGCCGACTTGCGATCCCTAAACAACGCCATGCAGCTCGAGCAGTACGA
CCACCTGCACTTCATGTACATGAAGGTTCTTCAGCGTGAGATTTATGTCATCCAGATGCGATCCGGGGACCTGCTGAACGAAATTTCGGGAGAAATTCAC
GCCTCCACTGAGCGTACGTATTATCGTGATTTTCGGATATTTATATCCTAGTTTCTCACTCAGATGTGTATTTTGAAATGCAGAGCTTGATCTTAAGGCG
ATGGATACGCTGCAACACCAAATGGAAAGTACACTTCGCCACTACCGAGAGGCTCAGATCCGCCTGCTCCAATCGCAGAAAGTCAAAATCAAGGATGTTG
AGGGCAATGTGCCGCTGAACCTGTTCCTCTTTTCCCTCAACTCATTCTGCAGCACGCTGATCGAGTACCAGGGGACGCACAACAAGAAGGACTTCCATGG
TGGCCGTCGTGCAAGGTCTTTCATTACATCGTCGATCAAGGATTTCTTCGCGACGCATCGTTACACTCGCGCAAAAATTCTGGAAGCTGCTCGAGTGTCG
GTTGCCATCGTCGTCGGCATCTTCATGGCCGTGTACCTCTACGGCTTCAGCAACACCACACCTGCCGCTGTGGCCTACGTGATGGGTAATCATATCGGAG
GTAGTTTTAGCGTCACGGTGAATCGTGTGGGAGGTGTCGTAGCCGGAAGTGTCGTGCCGTCGGTATTCCAGTTCTTCATTTCCCAAATTTGCGATCCCCA
GTTCCTGAATGTGTTCCTGTCGGATTTGGTGCTCTTCGTCTGGGTTACGCTGTCCATGTACGTGAAATTTGTCGAGGGCTACAGTTCGTACGCTGGTGTG
GTGTCGGCTTTCATTGCCGCGGGAGTTTTACTTCGCCAAACGGATGTGTGCTACTCCAACAGCTCGGACAGTTCGTCGACAATTGCGATCAGTTCGTACT
CGAGTCTCGCACAGACTTCAGTAGGTCTGGTGCTGTTTATCGTGGTGGAAATGGCGATGTGCCCCGAGAGCGCCACCAGCTTACTGCGCAAGAATATTCA
GCAAACACTCAAACTTCAGCAGAAGGCTTTCGAGATCCTTTTTGGTCACCACCTTTCGAGCTCTGGACAAATGAGTGAGGAAACGATAGAAGAGGTTCGT
GACATTCTACAAGTTCAAATTCCAGCGCAAATTGTCGAGCAGCGAGCGCTATTGAAGGAGGCGGAAGCTGAGCCGCAGATGTGGCGACCCGCGTTTTCGA
AACAAAAGTACGAATCTGTGCTAGACAGCATGGACCGCTTGCTCAACAACAACAATTTGCTGTTTAAGCTCGTTCGCTGGTACAACTACCGCGTGAAGCA
GAACCTAGCCCAGACGAACTCGGTCGACATTCGCGACGTGGGCACCGAGAGCGCGCGCGTGTTCGACACGAACGGTGGACACACAACTCACTCAAGGTGG
CAAGAGGCGAGCAACCAGTTTTTGTCGTCTGTGGGAGACACTTTCAACACGCTGCAAATGCTGTTCGGAGAATCGTTCCTGTACTCGGACCCGGATCAGA
CGGCCATCTTCATGCAGATGAAGGAAGCGTTCCGTGTAGCTGACAAGGATTGCAGCGGTGAAATCGATGCGGACGAAGTGGCGGTTATGCTTGAGATGAT
TTTTGCTCAGTCCGGTGCAGTGAAGCAGGACGAGATCACCAAATACGTCGCGGATTTCATGGAAATCGTGGACAAGGATTGCAGTGGCAAGGTATCTTTT
GAAGAGTTCATGGCTGCTCTGGAGGACGGTCTCAAACTCGAAGTGGAGGTGTACCACCGTCGAAAGCCCAAGGCAACAGCTCTGAAGCAGGCCCTGTCTA
GCATCAACGAGGACAGTCGTGTGGCATCGCGCGCGTCTCGAGCGAGCTGCAGCATCACCTCATCCAACGGAACTGGCATGGCGAACATCACAGGCAGCAT
GTTCGACACCAACACGCCGAAGAAAGATGGTCGGATTCTGAGTGCTGTGTCTTCTGCGCAGAATACACCGAAGAAGAAGTCTGGTTACATGAAGCGAGCT
TCAACCGTGATGACTTCGCCCATTCGACGCAATCACGATGTGCTGAACGTTGAGGACTTCACAACGAGCGATATCGCCGCTCAAATGAAGTCTGCGTATG
TGGAGTGGCTCATGGAAGGTCACCGATTCAAGCGAGTTACAATGGAGGAGTTGCTGTTGCTGAATTGCCTCGTCAGTGGCGCCGAAGGTATTGCCAGGAA
CCTGACCCTCATGGAAGAGATCGTTGTCGCTTCA