Description :
From Genome Similarity Track
Location :
Scaffold_2:190753- 201101
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001112candidate bifunctional a%2Ca-trehalose-6-phosphate synthase / trehalose-6-phospate phosphatase
Pytul_DAOMBR144PYU1_G001111Similar to DDB_G0276139: Putative uncharacterized protein DDB_G0276139 (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G001110Similar to FMP36: Protein FMP36%2C mitochondrial (Saccharomyces cerevisiae)
Pytul_DAOMBR144PYU1_G001109Similar to Cyb5r3: NADH-cytochrome b5 reductase 3 (Rattus norvegicus)
Pytul_DAOMBR144PYU1_G001108Similar to CCDC151: Coiled-coil domain-containing protein 151 (Bos taurus)
Pytul_DAOMBR144PYU1_G001107Similar to FBXL14: F-box/LRR-repeat protein 14 (Bos taurus)

Sequence
10348 bases(100 bases per row)
GAAGCGGATCGATATGCCCGTTTGAAGGCCGCCGCATGCGCCTGCTCTGAGACATCGTCGTCGTCGAAGCTGCTTGGTGGCGCCCACATCCGCCTCCTCA
TTTGCGCATTTGCCGCCTGAAGCGCACACGAACGGACCGTCCACCCGCCCAAGCGCATCAGAAGACCATCAGGACAAAGACAGCCACAATGACACGCACC
TCCACGGATTCCGCATCCACGACGTCGTCGGAGCACGAGCGCCAAGGCAGTGTATCCATTACGAACATCACAGCGATGGACGCGAACGATCTGTCGGAGA
ATTCCAGTCGCGATGTGATCGTCACCGCGTTCACTGGAGAAGCGCAAGGCGACGACGACGTGAGTGAACTTGACCGCAGTTCATGCGACGAGGCGAGTGG
CAGCGAAGCCGACTCTGACGATCAGGATACGCCGACGCCACCGCGCTCGCAGACCATGTACCGTGCCAATTCGCCACGCACGGGCACGATGCGGACGGGC
TTCACGTACGAAGACGAAGACGTGACAGAGATGAATGCGCGTGAGCAGGAGCTCCTGGTCGGTATCCAAGAGCTCCAAAGGCAGTTGTCCATGGTGCAGA
TCCAGACAGAGAAGCCGCAAGAAGAGATTTTGCCGCCTGCGACGGACTCGCGCCGCCGACTGATCATGGTTTCGAATCGACTACCGATCTCGTTTCAGAA
GAACGAAACCACGGGTGAATGGAGCTTCAAGATGAGTTCGGGCGGTCTCGTCACGGCGCTCAACGGCATTCGCGACGAAGTGCCGTTCATTTGGATCGGA
TGGCTGGGCGAAGAAATTGCGCAAGAAGATCAGAACAAGGTGCGCGAAAAGCTCGCGAAGGAGTTCAACTGCGTGCCCGTGTTCCTCTCCAAGGAGATCG
CTGAGCGCTACTACAACGACTTCAGCAACGACATTTTGTGGCCGACGTTCCACTACGTGCCGCTTCCGCTTTTCAAAGCCGGCAGCGAAAAGAAATTCGA
CTTTCGGCTATGGGATGCGTACAAACTCGCAAACAAGCGCTTTGCGCAAGCAGTGAACCAGGTGTACCGCGACGGCGATTACGTGTGGATCCACGATTAC
CACCTGATGAATCTGCCCGCCTTGTTGCGCAAGCGCCATCCTCGCTGCAAGATCGGTTGGTTTCTGCACACGCCGTTCCCGTCGTCGGAAATGTACCGCA
CGTTGCCTGTGGGAAAGCAGATCCTCGAAGGACTGCTCGGCGCGGATCTGCTCGGTTTCCACACGTACGACTATGCGCGTCACTTTCTGTCGGCGTGCTC
ACGGATACCAGGAGCTACGACATCACCAAAGGGCATTGAGTGGGAAGACCATTTCTCGTCGGTTGGCGTGTTCCCCATTGGTATTGACCCCGAACACTTT
GAAGGCATCTTGGAGAAGCCAGAGACGCAAACTCGAATCAAAGATCTCTGCGAGAAGTTTGCCGGCTGCAAGATCATCATTGGCGTCGACCGCATGGACT
ACATCAAGGGCATTCCGCACCGAATGCTCGCGATGGAGCGATTCCTGTCCAAATACCCGGAGCGCCGAGAGAGCGTTGTGTTGATCCAGATCGCGGTGCC
GTCTCGTACGGGTGTCGAAGAGTATCAGCAACTGGCAGCGAGTGTGAACGAGATGGTGGGGCGCATTAACGGCCGCTTTGGTACACTGCAGCACACTCCG
GTCCACTATATTCATCAGTCTGTGACGCCTACGGAGCTGGTTGCGCTGTATAATGTTGCTGACGTGTGCTTAGTGACATCGCTTCGCGACGGAATGAATC
TGGTAAGTTACGAGTACGTCATGTGTCAGAGCAAGCCGTGCGAAGGACGTCGTGAAGGCCCTGGCGTGCTCATTCTAAGCGAATTTGCCGGCAGTGCACA
GTCGCTCAGTGGCGCGATTCGCGTCAATCCGTGGAACAACACGGATATGGCGAATGCGCTGGAGTATGCGCTCACGTTACCAGCGATTGAACGCGAATAT
CGTCAGTCGAACCTGCATCGGTACGTGAAGACCCACACGGCGAGCTTTTGGGGCAAGAGCTTTCTCACGGAGCTCGAGTTTGCTGTTTCGCGTCCGTCGT
TAACGAAGAAGCTCGTCAAGTTGCCAACGATGGATGTGATCAACGCGTACAATCGCAGCAAAAAACGCATCATCGTGCTCGATTACGAAGGAACGCTGCT
GGACGAATCTCACCAGCGCTCGACCATTGCGCCACCGAAGGCCGTCGTGAAGCGCATTATTGAGAATTTGGCGGCCGACAAGAAAAACACCGTGTTGCTC
GTAAGTGGTCATGATCGAAGCGTGATTGGAAGCTGGCTGAATGACAAGCGCATCGGCATTGTCGCCGAGTCTGGGTATTGCTACCGATTGCCCCACGAAG
ACGAGTGGGAGACGATGGCAGAGGATATGGATCCGTCGTGGAAGCGCGTGGTACGGCCGATCATGCAGTATTTCACCGAGCGAACGCCTGGCAGCCGCAT
TGAAACGAAGGAGAGCTCGCTGACGTGGCATTACGGTGAGACGGACCCGATCTTTGGTCCGATGCAAGCGCGTGACATGCAGATCAACCTCGAAGACGTG
CTGTGTAACTTGCCGCTGGAGATCCTGCAGGGCACGAACCGCGTGGAGGTTCGTTTGCAAGGTATCACCAAGACTGTGATCATCGAAGAGGTCTTGAAGC
AGTTTTACCACGCACAGTCGCCTGCAAATACCCCCAGTTCGCGTGCAACGTCGCCCCCATCGAGACTGAAGAAGCCGCAGCAGGAAAAGCAGCAAGTGGA
TTTCGTGTTTTGCGCTGGCAACGGTCTCGAAGATGACGATCTGTTCACGTTCTTCAAAGAGCACCAGGAGCTAGCGAAAAAGGCGTCGCAGTCGGCCGTG
CCTCCTGCGCCTGCGAGTGCTGCGTCGACCACGCCAAGTGGGCTTCCTCCGCTGCCGCCACCGCCTCCGCTTGAGTTCACTGGTTCGTCAGCGATCATGT
CGTCTGCACTATCCAACAAGGCCAACGTGTTTACGTGCCACATTGGCGCCAACAAGACCGAGGTAAGACACCGTTGCTCTTTCCCCTCCTTCCCCCATCT
CTCCTGTGAATCATTGTTTAGTCTGACTCGTGTGCTTACAAATATGTATTGTTTGTTGCAGGCCATGTACTACTTGGAGCGTCCGTCGGATCTTTTGCGC
GTGTTAAGAGGTACGTCGTTTTTTCCATGTCACACCCCCGGAACCCATCGATGCGGCATTGTTGAAGTACGCTTTACTCATGATTTTTTTCCCTTCTGTG
TGTTGTGTAGCGATGTCAGCTCACAGTCGCGAAGGGTTCATGGGCCACGAAGACGCGAGTGCGGCGATGGATCCGCTGGTGACTGCGATCCCCGCCACTG
GCCCCGCTGCAGGCTCCTCGTCGTCGACATGATGAAGTGCATTGAAGTTTTTATGATTTGTTTACCAAAAGTTGTTGCATGTCGGGTGCGTATGCAGTGA
AAAAAATCTGCTGAAGTTGATGGAATAATACCCCCCCCGTGAGCCACTATTGCGACACATCGTCGTAACGTTGATGCGAACGTAATCTACTTGCCTGGGT
GATCTAGGGATAGGGGAGGAAAGAGTACAAGTCGCCACTTGTCACCGATTTATCAGTTTAAAAAGGTATTTGTAAATAGCGCATAACTAGATAATCTCAA
AATGAATCAATGCATATAGACAGGGTATCGATTTAGCAAGGCAATAGCACTAATTTTGTTTGGTTCCAGTTCGCCCCGTGTCCGACGGGTGCCTTCAGCC
TCTGAGAGCTGCGCACTCGCTCCTTCGTTCCTGTTTGCCAGGCGGCCGATTCCGTCGGTCAAGCTGGCACGCTGGACCTTTTTCCTCCTGTGCCGATCCG
CTGGTGCCATCTCTCCATTCCGCAATTCTCTTCCGACCAGCGCCGAGTGCTTAATAACTAATTACGGAAGATGTGTCCGCTGCGCTACATTCTGCTGCTG
CTGTCGCTGCTGGTGGCGATGATCGGGCTGTCGCAGGCCATGTCGGAGCAGGAGATGTCGGCCGTGACCAACGGCGACGAGGACGACGAGAAGGAGGCGA
GCCAGCAGCAGCAAAAGACCACGTTCCGCACGCTCGTGGACATGCTTAACGGCAAATATTTATACGACGCGTACAAGGCCAGTCAAATGCGCATCAAAGC
CGAGTAAGACACGTCGTCGTCTTCACCAAGCGCAGAGGAAGCAACATCAGAGAACATGGGGAAGCCAATGCGGAACGCACTCACACTGGGCGCTTGTGCA
TGCGAACAAGCGAGACGAGTTGCTCTAGCGTGTATAGATATGCTATATTTTTATTATTCTTTTTGACTCAATTTTCTAATGACGGGGAAAGCGAACGAAT
ATAACCTCTCATTTGCTGAAACCCACAAGTCGCGGTCGATATGCTCATGTAACTATCGTCACCTTATTTTTTTGTGCATTTGCCCATTACAGCAGCAGCT
TTTGCCAGTCTTGTTCAAATGTGCTTTTTATTTGCTTCTCTCCTTTTTTTCATAGAAATACATCAACTTAGCTTGGTCGCTGGCACACGTTGCCCGAGCT
GATCACAAGCGGTTCGCTCGCAGACTTCTCCGTGATCGGCGTGAGTTCTTCGTCTTGGCGCATGGCTTGGCGTTGCGGGTCCGTGATCGTCACCTCGTAG
CGCGGCGCGCCCGAGTCCTCGACCGCTTTCTGTCGCCCCTGCACGATGTGGTGGAGCAGCATGCCCTCGGCTTCGTCGATGCCCTTGATCAACTCGGCCA
CGGTCTCCTGGTCGCGCACGTCGCGGTTCTCGAGGAAGTTGTCGCGTAGCGCGAGCCGCGCCTGCTGGATCGCGTAGTCGTCGCCGCGGAATGCCTGGCG
GCTCGCGCGCAACAGGCGGCGGTAGCCACCAAGCACCTGCACTCGTGCACTCATTCTGGGAACAACACAAGCTTCTTTTCCGTGTCTGCTTCTGTCTGTG
TGGATGAAAATCCGAGCATGCATCATTGGCAACAGGGCCACTATTAAGGCTGTATGTACGGAAATAACGTGGGACCACACTACATTAGCTCAGTTTATAG
TGCACCACACTATTGTGAAATGCTGGACTTGACGAGAAAATCGACGGGAATAAGGTAAACTACATACTTTTCGTACATGTTTTGATGTGCGCCACACTAT
TTAAAAATTACCTCTATATAGTGACATCAGAAGACTGACTGGCGGGTCTCAAGAATACGTAGATGCGTAGGTGGCAGTGACATCATTGCGATCCACTCTC
CCCCGCGCTTCAGGAGGTCCACTTAATCGGCTCATTCCCCCATCGCCCTCTTCTTCCGCAGACCGAAATGGACGCGCTCGTGAGCCTCGCGGGCGGAGAC
GTGCGCATCGTGATTGGCGTGGCCATGGTGCTCGCCACGACACTGCTGCTCGTGGTCTCGGGCGCGCTCAAGCCGCGCAACAAGGCGCTCGTGACGCTGC
AACCGCCGGCCGTTGAGGGCGGCAACCCGCCGACAGTGCACCTGCCGCTGGTCGAGAAGGAGTCGCTGTCGCACGACACGCGCCGCTACCGCTTCGCGCT
GCCGTCGGAGAAGCACGTGCTCGGTCTGCCTGTGGGCCAGCACATCTCGCTGCGCTACACGGACAGCGACGGCAAGCTCGTGATGCGCTCGTACACTCCC
GTGAGCTCGGATGACGCGCTCGGGTACGTCGACCTCGTCGTCAAGGTGTACTTCAAGGACATGCACCCGAAGTTCCCTGATGGCGGCAAGATGTCGCAGT
ACCTCGAGTCGCTCAAGATTGGCGAAACCATCGAAGTCTCGGGCCCCAAGGGCAAACTCTCGTACATGGGCAAGGGCGAGATCCACATCAAGCACCGCGT
GCGTGACCCGGCCCCGGAGATCCGCGTCGCCAAGAAGATCGGCATGATCGCCGGCGGCACGGGCATCACGCCCATGCTTCAGATCATCCGTCGCGCGCTG
CAAAACCCAGAGTACGTGTTTGTATTGCGCCTTATTTTGTTGCATCTTGGACGTGTATCAGGGCTAACGCTATGCATTGTTTTCCCCATTAACGCAGTGA
CAAGACCGAATTCTACTTGCTGTTTGCCAACCAGTCGGAGCAGGACATCTTGTGCCGCGAGGAGATCGACGCCATGGTGCAGAACCACGCGAACGTGCAC
GCGCACTACACGATTGACCGCGCGAGCGACGGCTGGAAGTACTCGGTCGGCTTCGTCAACGCCGAGATGATCAAGAAGCACCTGCCGCCGGCCGCGGCCG
ACGTGCAGATCTTCATGTGCGGCCCGCCGCCGATGCTCAAGTTCGCGGTGTTGCCAGCGTTAGAGGAGCTCGGCTTCACGCCCAACCAGCACTTCAGCTT
CTAATTGCGCGAAAGACAAACGCAGAGAGGATAACGCACAGCTAAGTCATTTTCATCAACTACACGTGCTTTATGTGTGCGTATCCTGTAATGCCAGCAA
TTGATTCGTTCACTGCCTACTTGCTCATCGCTTCTTGGGCGAGAGCATCTTATTGAGTGGCGAGGACGCACCACTACGGACACCATTGCCATTGCCGTCG
TTGCCCGCGCCACTGCTGCCGTTAAGCCCCGGAATGATCTCGTCGTCCGACGAGTCGTTGAGACTGTCCTTGACGCGCTTCTTGAGCACGCGCTTCTTCT
TCTTGTCTTGCGCGAGGATGACCTGCGTTGACGCCTTTTTCACACGGTCGCGACTCAGTGCTTCCTCGGGATCGTCGAGCATCGTGCCGCCGCCACCGAT
AGCGTCGTCCTGCTCCATTTCATCACGCGTGAGACCATCGCCCGGAAGCGCAACGCGCTGGTTATACGGCCGCGAGACCAGCATGTCGCTATCAGACACA
GACGCTGATGCAGCATCCGACAAACTGAATTGTGTGCTACCAAGCCCTGCGCCGCGCATCGTACCCAACCGCACAACATTGTCACTTTCCTTCTTCTTCG
TGGTTCCACTTGGCTGCTGCTGCTGCTGTCCTGAAAGCGATCTGCCAGCGGCAGTGCTGGCTTTGATCTGGTTCAGTAGCCGCACGAGCGTCATCTCGCT
TTCCTGGAGCGCGTCGACGATGGTCTCGTCCGTTACGACCACGACCTGATCGTCGTCGCGGACGCACTCAAGCTTGTCCACCAAGTGCTCCACGCCAGCT
TTGACGCCGATGAACACCTTGGCGAGGCGCTCGTACTTGAGTTTCGCGCGCTCGAGCTTGGCGCTCGCGAGCACGAGGTTCTGTTCGTGGTCATCGACCA
TTTTACGACGATGGCCGCCACCAGATCCGCTGTATTTGAGCTCTTCGACGCGCGCCTTCAGGTTGTTGTGCTCCGCCTGGAGCTGCTCGACGCGCGCCTG
GTTCTCCTTGGAGAGATTGATGAGATTATCAGTCGTGCTCTCCTGACTCGTGATCTTTTGGATCACTTCGTTCACGTCGCTCACGCCCGTGGCTTCTTTG
ATCTTGCGGAAGGCGCTCTCGAAGATGTCAATCTTGCTGCGGTGCTCCTTCTTCTCCTCGACCGCCATGCCCTGCTGCATGACCGTCATGGCCAGCGCCG
ACTTGAGATGCTTCTCCTCTTCGGGGCTCAAATCACCTGATTCCTTAGCAATCATGTCCAACTTCTGTTTGTCGCGCTTGTCTAGGCGCTGACTCATCTC
GAGGCGAATCCTCACGTACTGCTGCTTCTCACGGAACTCTTTCTCGCGATGCCGCTTCTCCTCCTCATACTGACTACGCGCTTTCTCGAGCTCTTGCAGG
ATCATCTCGCGCGCATGCGTCGCATCGGACGAGAGCAGTACGAGCTCCTCGTAGTCGTGCTGCTTGGCGCCTAGCGCTCGCTCGATTGCAGCCAATTGGT
TGTCAAAGCCGATGCGCTCTTCTTTCAGACGCTTCACGATCTGCTCGTACGTTTTTCGAATGCTCTGTGCTTCGTTGTACTTTATCATCGCCTTGTCTAG
TCGGTTCTCGAGTATGCGAATCTTGCGCGTCTCGGGTGTGTCCTCGAGGCTCGGTTTCTTGGATTCGAGCTCCAGGTCTTTGACCTCGTCCTTCAGTTCC
TCCAATAGAGCAGACTGCGATTGCACGCGATGGCGCACTTCGTCGTGCTGCCTGCGCATTTTGTTGAGCTGCACCACGACCTGCGCGAGCTCTTCGTTGT
CTTCGCCGCCTATGGTCGCGACTCCAGTGGCAGTGAACGCGGAATTCCCGCCACCCCCCATACTTGCGCCGGTATTCATGCGCTTAATGTCAGCAAGTTG
CTTCCTCAGTTCGCGATTCTCATTCTTGAGTTGGCGAATGTACTCCTTGTTGGCGTTCTTGCTCGTCTCGAGCAAGTCGATGTTGCTTTTCCGATCCACC
TCTGGCGATGGGCATTAACAACACGAACAATCATGACAGGTGAGCTTTCAAACCCAAGCAATCAGCGCATTTGAAGAGCAAATTTGCAAATGGCACTTAC
GCAGTAGCCGCATTTTGTCGCGCAGGTCCTCGACCTGCTCTTCCATGCGACTGTCATAGTCCTGTTCCATGCGCTTGAGCGCATTGTCGTGCCGCGCCTG
CATTGAATAGCTTCGATGGTGTCTTTGTCACTCTCTCTCGCACAAGTGAAGCTTTTATGTTTTCGCTTTCAACGCGCGCAGCTCCAAAGGCGTGTTCTCG
CTATAAAAAGAGAACGGAATGCAAAATGTCGACACTTTTGAAACCCTCTCCTGGTAACTGACATTGCATTGCTCTCGTTTCATTTCATGTTCTCTTCTTA
CTTGTACGTACACAGATAACCACTTAGAATCTTCTCTCTTACTCGTCATTCACGCATCATCATCATCAATCACATCTCAAGTACCGCAGCTCAGGCAAAA
TATCTACAGAAAACAATGATGTGAGGTGCGTCTTCAATTGATTGATGCAACAGAATATACGTTCCTACCTCTCAAAACGTCGATGTGGCTCGGAGTCAGC
GCGCAGCCGTACACAGACAGCGATTGAAGCTCTTTCAAAGCTACTCGTATAGATAAACAATAAACCATGAGTACAAGTTCAGCAATTCCCGTTTCAACCA
TTTCGTGATTGCAACACGTACAATACAGATGCCGCAGCGAAAGTGCCGAGATACTGGTGTTGGACAAGTTCAGATAGCGCAATTCTGTCAATGAGCGGAT
GTAGACCAGCGACTTGGCGTGGATGTTCCTGTTCACACATGACATGGAGTGAGCAATATGTACCTCTCAGTACAACACAAATGGCTCAAAAGCGATTAGC
TCGGTACCTGTTTTGGCTCAGATTGAGCGACGTCAAGGTAGTAATCTTGGAAATAAGTTCGACGCCACGATCGCTGATGGTTCCACTGCAAATCTCCAGC
TCTTTTAAGCGACGCAGCGGCACGAGATGCAGCAGCCCATTATCCGTAATGCTGGTCACAAAAAACCGCGACACCAAACAATCGTGAGAACATTTCACGA
CAATAAGTAGAGTATGATAATTTTGCAACCATGTTACCTTGCACCAAACAAGTCCAGCTTCTCAAGTCGTGGAAGGCAAGTCAGGTTCGCCAATGATCGG
TTCGTAATTCCTGACGTATCCAGTGATAAAACCTCCAGGTCCTTGAGATTCGCAAGCCCCATTGTCCCGGCGTCGGTCACTTCGGTACCAGAGACATCGA
GTGCCTTTAAATAAACGTTGTGCTTGCAAATCTCGATGAGACCGGCATCTGTCAGCGCTGTCTCCGCAAGCACAAGTCGCTCTAGTCGTTCCAGCCGATT
TATAAATTCAATTCCTCTACGCAACGCCGTGACTCATTGTGAGAAACCATGCAAGCACTTCCAAAGTAACAATACCCAATGCCGCATACCTCTTTAAAAT
TCGACACGATCGAAGATCGAGTTCTTGTAATTTAGGCATGTATTGCAAAACAGCAGCATCAGCCTCGCCAAAAGACGTGCGCCCAAGCAGCAAGACACGA
ATGTCTGTCCATGAAATCGGCAGCGAACGGATTTCCTCGCAATGCCGCGCGTCAACGTATTGCAAACACTCAAGTCCCGAGAGTGACGACATGCCATCGT
CGCTGATATCGTTGCAGCCACGTAGAATCAACGTATTCAGCGTACGAATCCGTCCAATCTTTCGCAAAGCCTCGTTACTACAGCAATTCCAACACAAACG
TAGCTCATGTTGGTTAACCAGACGCAACCGCATACAATACAGTAGATTAGAGCACACAACTCCTACCTTATACGGCAATGAGAGACATCGAGGTAGCGTA
AATGCGGATACGACATCGCTATTCCCTTAAAGCCGGCATCTGTTAAGC