Description :
From Genome Similarity Track
Location :
Scaffold_121:19075- 29455
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_121-snap-gene-0.27DnaJ (Hsp40) homolog, subfamily C, member 13

Sequence
10380 bases(100 bases per row)
CCAGCGTTTGCTATTTGCTTGCGTCTTGTGGCGGCTGTACAATGCAGTCGCGCGGCGTCCGCGCCTTGTGCTAGTGAGCGAAATCAGCGACGAGTTGGTT
GACTGACCAGTGCTTGGCGTCTTCCACGAATCAAGCAGCGAGTATCGGCGCTCGGACCCGAGCTCACTTGGAGGGGCGACACTGCTTCGCGCGGCATTCC
CATTGGTGGGGCGTGTCGGTGGATAGCCACCCAAATAAGACATATTGCTGGATGGTGGAGGCTCCAGCTGGCCCTCGAGGGCCCTCACATCTGGCATGCT
TCCACGATGGGTGCTCGGCTCGTCAATGTCGATACTGTATTCGGCAGCCTTCGCAGCGTGGTAATCCGTGTGCGCAGGCTCGTAGTTTGCGCGCAGAGTC
GACTGTCGAAGAAGTTTCGGCGACGACAATGGAGACGGGTTCGAGGCGTTACCTTTGAATCGAAAGCTTCGAGGGGCTGGTGCCTCAGTGACTTCAAACT
TCTCTCCGTCGAAATTGATGCTCTTTGGAGGTGCTTGAACCCGTTCTTCCTGCTCAGCTTCGTTCTCGCGCTCGTCATCAACCACAAAAGTGCCATTGTA
GGTCGAGTTTTCTCTCTCATCATCAACGTTGAAGCTCATCAAACTCATCGACATGTCCTTGTCACAATTGCCATCGATTTCTGTGTCGTAAAAGCTGCTT
GGTGGCGGCGGCGCGCGTTTCTCATCATCTCGGGCTTCTCGGACTTTTTTTTTGAAAGACTTTCGGCTCTCCGTCAAAGTCGCGTTGAGCCAGCGCGTGC
TCGTTCTTTCCATGAAGCTGGAAGAAATAAAGCTTTCGTCCCGCCCACGCTCGCTTTTTACGATGCGAAGAATACGATTTGCGTTGCTGATCACAGCGTT
GTCAGTGGTCGACTGCTTGTTCTCCACCAGCGTCTCCAGAAATTTTACCATCTCCGAATAGTACGTCAAGTCACGTAGGAGGAAATCCGAATCTGGTTTG
CTTGATCCATCAGCTGGCGGAGCGCTTCGAACTTCCAGAATGCGGCGAACCAACTTCAATAGAGCCGGGATGTCAGGATGCTGCATTGTGATTCGGCAAC
TGAGCAGCTCCAAGAACTCGCGGGAAACCATCTCTGGAAATTGAAGCAAACGACGGGCAAGACGGAGAACGCAACGATACGGGAAGATTTGCACCATGTG
CGAGTTGCAGTGGCGCACTAGCTTCACAATTTGGTCCGGGATCTGACTGTTCGCAATACTCTCGTCGATGTCGAGAGGGGCGCGTAGAAGGTACGTCATC
GCTGTGGTCAATTTCTCAACTTCGTCGGCAATTGCTTGAATCTCCGTCTGTGGACTCTGAAGATCAATCGTGACGAGACTGTCCCACTTGGTGCGCCACA
GCTGGAAGAGAAGCTCGAGGTTGTGCGCTGGGTTTGTCAATGCTTCAGGATCCGGGCGTGTAAGGAAGCGATCGAGGTACAATCCGGCCACGAAATTGTT
CGGATAGTGGACATAATCCGTATCATCATCGAGAATGACCGAGTCGCGCTTCACGAGCGAGCGCTCCAATCGGTTTCTGCAAATGATCTCATCTAGTTTC
TTCCGAACCTCGGTTCTCCAATGCGAGTTCCAAATTAGATCGCTCTTGTCGTGGTTGTCGTCGAAGAACTTGGACGCTTTGGTGTAGTCCAGATGAATTT
GGTACACGAGGGGGTACGGTAGAAATCGGCAGAGTCCGCTGTACATTTTCTCTCGCAGCGTAAAGTCTTTCTCAAAAAGCGCGTAGAGGATCTCGAATGC
CGGTCCTCGCAACGCATCCGCGCGAAGGAAATTTTCGTGAAGTACGTGCTGCTTGGATTGAAGCGCGACACCAAGAATTTCGACCCAAAGTCCACTCGAC
TCGACGTATTCGGCGATGCTGAGGCATGTGTCACAAAGCTCTGCTAAGCACGACAGCGCGAAAAAGGCTTGGTCGTATCCAAGGTGGTCGGTGATGACTT
GCAAGCTCCATGTGAATTGGCAGAACGGAACAAGCATCTTTTCCAAGTTGCACTGAAAACCGCAGATTTTGTTGAGGATGAGAAGAGCGAGCTCTTGACG
AAGCAGGTACTCGGTGTTGCCAAACTCGTTTTCCATTCCAGCTGGAAGACCCTCAGTGTTGCCTTGCTTCTTGAACCCGTACGTTGACAGCGATCGCCGC
GATGAGATGGAAAAGCCCTTCTCCTCAGCAACTTTGTCAAATGGTAGGAGATATCTGCCCAGTGTTGCGACAGAGATTGACGCGTTGACAGGGTCCAAGT
CGTCCACGTGTTGCTCTAGGCATTCCACAAAGGATATCATAAACGCTGGAACATCTGCTAATACGCTGAGGCATTCGAGGGCGGGGAGAGTGTCCGTGTA
AAGTCCGAGGCTTGGATCTCGGTTTTCGTTCAGGAAGATGAAGATTGACTCCAAGAAATCTCTCGCTGAATTTGCGTCCAGATAGCTCTCGAGCGAACTG
GGGTTCTCTTTCGCTTTCTCAAGAAGAATGCTCAGATAAATTCCTCCAACGACAGGCTCGTCCTTCACGCAGTCGTACATGTAGTTCATCGAGCTTTCCA
GGAACGACAACTCGTCGCCATTGGCGTCCATACAGTATTCTTCGATAACCTGCATCAACTCCGAGCGCATACTCTCGTTCCAGATGCAAGTCGGTTCGCG
GACTTCGGAAAGCAAGATCTCGCAAAACTCTTGTCCAGTTGGTTTCTCCAAGTAATCCAAGAAGTCAACCGGGAGCAAATTGGCGAGTGCATCCAACGCT
TTCGATCGGCTGTCGCCGTTCAATCCCAACGCGATAGCTTTGATTGCGAGAAAAGCACTGTCCAGCGTTTCGCGTTCTTTCTTGTGCTGAGCAACCCCGG
TGTCTCCATATCGATACGCGCTCGCTCCTTCTCCAGACGTCAGCATGAGGTACAGCCCTTTCCAAAAGACTCTTGTTGACTCCACAACTCGGTTTTGAAG
CTCGTGCGATCGACAGAGAGCCGAAATGATTTCAAAAGAAATCTTCTGGAGCTGCCACGGCTGGATGTTCTCGAACGATAGCATGAGCTGATCAACCAAA
ATGTAGATGCGCTCTCCGTGTTTGTCGTTGCTCGTTTCAGCTTCAGCTTGAGAGTTGTACTCAGCAGCGGTGAAAAACGTTGAGATATCGTCTTCGTCGG
TCCCAAAATCAAAGCGACTTCCGGGTGGAGCTTGTACTCTGCCTCCTCCTCCGTGAGTGAGAGATCGTATTCCTTCGTCGGACGCAAGAATCAGCAGCAA
TATCGAGAAAATATCCTCTTTGGCGTCAACATTCCGGCCAAATGCGTGATGCTCAACCGCGTCGAGAAAAATTTCCCAGAAATTCTCGACTCCCAGTAGC
AGAGCAATGTTCTTTGGCGCAGATAGAGCCAACTCCAGAAGAATCTTTCTTGACATTTCTTGGAAGACTGGCGATGAACCTTGGTCCTGAGTGCCATCCA
CACCGATCGGTGGCGCGAGCAACGATATCAACAGGTCAAGCGTCTTGGACTCAAACGAAAAGAACTGGAACTTGAACTTTTGCAGAAGAATCAGTTGAGC
TTTCAGGATGCAATCGATCACTTCGTCTGCTGTTCGTCCGAGATCCATTTCATCTTTCCGACCAAGTCGGCTGCTCAGCGTGTCGAATGCGCTCCGTACA
GTTGTCACTTCGACTCCTTTGGTGCATAGTTCTCGATATCTCTCGCGAAGATCAGCCAGCGTGTACAGCATCTCTTCATCCCAGCCGAAAACCTTGAACG
CTCCAGTGTCGTCAAGGGAGTCCAGTCCCCTCGCTTGACGCCGAATCAAGTAGCGCCACTTCTCCTCAATGCTGCCCATCAAGATCAGCGGCTGCTCGAT
CGCATCAACCTCAGCTTCTGACTCGACCAGCGTTGACAGGTAGTAGCCGCTGCAATAAACGTCGTGCGAGAGCTCCACGTAGCTAACAGGAGGAATCGGG
ATGTAGCTGTACGTAGCTCCGACATCGCGCTCCAAATCCTCTTTGAACTCTTCAATGTGCTCTTGAATCATCCGTTGCAAGTGATCTCGCATTGCAGTAG
ACCACAATACTCGCTTGTCAGCTTTCCGGAACGTGTAGATGTCAGCAAATACTTCAGCAGGCTCCGTGTCGAGGATCGTGATCAAAGACTCGGGAAGCAA
ATCCAGAAGATAGCTCTGACCTTTGTACCGCTCCTCTGACTTCTGCATCCGGTGGATTTTCTTCAGCAGCTTGGCTTCGTAGACAAAACTCTCGTCGTTG
CTGTTTTTCGCGTTGGGGTCTGCAGCGAACATGAAGAAGAACGCTCCGCATGAAAAGAGTTTCTCGAGAACGGCGTCGCTGAAAGACAAGAGAATTTCAC
ACACTAGTTTGTGGGCCACCGCGTTGTCAATCAGCAAGAGCTGAGCGAGCTTCGCAACTGACGAAGGTTCTGACAGGATACTGTTCGTCAACGGCAGCGG
CCACACGTTCGCAGAGGTCGATGACGCGATTTTCTCGTTGAATACAAAGTTTCGCAGAATTCCCAACGCGTACGTCGTCGTTTCAAGAAGATCGATCGAC
TGGTCAGGTAGCTCCATCCACCGCAACTCTGGAAATTCAGCGAGCGATTTCCAAACATGAGCGTCTTCACCAGCCTCCGCGTGCTTTGAGCAACAGCACA
CGACCACGCCAGAATTGTGCTGACGCCTGCTTGCTGAATCTTTCTCAAGGAACTCCTTTAGCTCGACTACTGTGAATGGACCATCGATCGCGCTCACGCT
CTCACCCTCAGACTCGTCAGCCATGTGTTTCGCGCTCCATTTGAGATTGAACCGCGAGTTTCCAATGAAGGACATCCCTGCAATCGGCAAGGATGATGTC
GAATCTCCATTGACTTCCATCAATGGAATGTCATCATCATCCTCACCGATTGTAGTATCTCTACCAATCTGCTGCCGCCCGTTTTGAAGTTTTCCTCGAT
GACCCAGCAAGGCAAGATGCAGGAAGATCTGGATGATTCGCTTCGAGCAAAATTGCTCTGTCGCTGCGTTCGCGAAGCTCATCTGAAACATCAGCTCCAC
GATGTCTTGGATTTCTCCAGAGACGAACGAGTTGTTCAGCAGCTGAACCAGAAACTTGGCACGATTGCGCGAAATCTCTCGAACGCTTGGGAAGACTCGA
GCAATCTCAACCAAAATCTTCAGCATCCAGTAGCAGCTGTCTTCCGACTCGCTGCTCTTTGCCAGACATTGAGATGAGTCTGATAAACTGCCTGGTATTC
CAAACGCTCCATAGTGCACCAGTCTGCCAAGGTGCAGGTTTTCCAGCCAGCATTGATACACGTCGTTGAAAAACGTCAACGGCGACTTCGCGATCTCCAC
GCTCGCGTGAAAGAGATCGGCCGATTCGCCGTCAGCAATTAGACTTTTTGAATGGATTCCGTTTGAAGAGTCCAATCCACTCGCGACTTGATCCAGCTGA
AGAGTTCCATTCTTGATCTTTTCATGAAGCACGCGAAGGTAAAACCGCCCAGCTTGTGGTTCCTTGCTCAAGCACTCATACTCAACGCGAAACTGCTTGT
GATTCCACTTTGGATCTGCAGCTGCTTTCAGCGATGACCCGATGGAGGATTGAAGCGAGCTCGAAGGCACCGACGCAACCTTTTTCCAAGAGTCAAAGTC
TTGGAGTGCGTTCTTCAGAGCGACCTTGAGCTCCTTTCGGGCTTGGGCATTCCAAATCAAGTCTGGGAGGACGTAGTCCTTTTGAAGCAAATCTGCAAGA
AGCCCAAGATCTGACGCTGATTCTCCCGAATAGTTCATTCTGCTGTTGTCTTCCTTCACTTTCACAGCGCTTCCGTTGCTTTCGGGTGAACTCGAAAGTA
CTTGCTGCTGCATCCGCTGGATGAACCACGCCGTGGCGCTGTTCTTCACTTCATCTTTGCTTGCCTTCGAATGGTTCTTCGTGTCAGTCTTGTACTTCCG
CTCACGTTCTTTCTGGATTTTCTTTCTTGTCGCGACATGCGAGATCATTCGGAGAAAACCATTTGGTAGTATCCTCAGCAGCATTTCATACGATGGCTTG
TGGTGTACAATCCATATCGCGCCAATGTATTGATACACCTCTCGACCTTCCTTGCTTGGATGGAAGAATGCTCTCTGGAGGTCACATAGCGTTTGACCAC
TCTCCAGAGCTGCGTCGCAGATTCGCTGTCGAACCTTCGCATCTCCATGATCGACAAGAAGCTTCAAAACGGAGATCGCAGTCACCATCACGCCGGTGTT
CTCATTTTGTCTTGCAAGCTCCATAAGCCGAGCGTGTTGGGAGCTCAAAGCCTTGATAATCACGTCAAAGTGATTGCTGTCGGTGCTCAGACGGGTTGTA
GTCAGCACTTCAAGGAAAAGCTGCAGAACCGCGATCAAGCAATGTGGCTTCTGGAGATTCAGAATGTCCACAAGCTGCTGAAACAGCTTCTTGTGCTCAA
ACACGAGGTGACGGTTGTTCTTCTCAGCAAATTTGTTCACCGATAGCCGTGATCGATCCGCGACCAGAGAGTGTAAGGCGTTGATGGACCACAGCGTTGA
CGTGGGCTCGCCTGACACCACGAGCTTGATCAAGATATCCGTGATCGCTGAGACCTCGTTGTGTGCTTCAGAAACCATCTTATAGCAGCCATCAGTAATT
CGGCAGAATGCGTCGAGAATAATCGAGACCTCGTTCACGCGGATTGGTGGCTTGCACGATTGCTCGAGCTAAAAACACAAAGAATTGAATTTCAGTCAGT
CAGCAAAGTCGGCTAATGAGAGCAGATACGCACACACGTATTTGTGCAGCACTTACCAAAATTGACATCCCGCGCAAAATCGACCCGAAATTGAGCTGAG
AGAGTCGACTCTGAAGGATCTTTCCAGAGAAATCGTCCGCGCGAACATTCAGGTTCATGTTTTCGAATGCAAACATGACCTTATCCGTGGCAGAAGTCGA
TGCCAACCCTTCTTCTTTGGCTTTCTCGATTTCCTTGGTGAGCTCAGAGTGGGCTGGAACATACAGTCCTTCGTGGTTCAGATAGAAGTAGCGCTCTAGT
TCATCCGTCAGCAGTGCTCTGGCAGTCATCCTCGGGTTGATTTTTGAGAACTCGCTGCCGAAGGAAACACCCCAATTGTTGATGAAGCGATAACCGTCGT
ACAACACTCCCAGGAAAGCGTCTGGGTCAGACGGAGCGTAAACCAACCGAGATCCGTCGCTGAATTCCAGAGCAACAACGGTCTCGTTGTTCTCCATCTC
GGGGCGTGGTGCAACAACACGGCGCAAATTCCGTAGCGAGTACGTCTTGTCAGAAGTGCTGTCAACCTCTCGAATGCTTCCATCGACCACGCAAATCTTC
TTTCGACGATATCTGGTTGATCCGTGCCTTCCTGTCCTCTTTTGAACGTCAAGCCAGCTGAACGAATCGAGACGATCTTGGTCGATCAGCACTTTTGTTT
GCTGCTTTGGTAGTTGGTCTCGAGTCACGGATCGCAAACGAATACCAATCGCGCCGGCAAGACCCTTCGCTTTCTGCACAATCACTTTCGCTTGATCAGA
GTACAGGTACTTGAGTTTCTTCTTCACGGTCAGGACGAGCGCATCCGGGTCGCTGGTAGCTTCGACAATTTCCTCGATTGACCTGAACTCGAATTCGTGG
GTCTGACGATTCATCACGCGAACAATGATCAGCGCTCTTGGAGTAAGGTAAAAGTCACTTTTCTCTCGCTGTCCACTGGAGGTACTAAAAATTCCGCTGA
ACTGGTAACACTCCATGCTGTAGACACGTTTGAACTCATCGAAGCTTCCAATCATGTGGCTCATGAGCTCTTGCAAGAAAACGTTGCGGCAGCGGTACCG
AAGTCTCAAGAAGATGGGTTCATCGTATTGATCCAGCTGCTTCTTCAAGGAGCCGCACGAAGATTCAATGAACAGCCGATATTGACGCAGCAATACCTCT
GGATTCTGGACCGCAACGCCGCCACTACCATTCGTGCTCCCGCTCGACGATATCGAAGATAAACTGTTTCGTCGAATGGAGTTGTAGCTGTTCCGTCGTG
ACAAAATGCCATTTTGTCGACCCGAGAGCACATTGTTTCCACGATTGCTGCCGATACCGCCATAATTTACGCTCTCGCCAAAAGTCAGCGAATGGTGCGG
AACTTGTCGATTGCGAGAGCTTCCCAGCTGGCCGCCCCCAAAGTGAACAAAATATGGGTTGTTTGTCATTCGGCTTAGAAGACCAACGCACGACTCGACG
GTAAGCAGACTTGGAAAACCGAACAGAATGCGCTGCAACATTCGGTACTTTGTCGACAAGTTCTGATAAAAGCTCAGCGACAGCTTCTCGTGCTTGGCGA
CGTCAGTCTTCACCAGGGACAGTATCAGGCGGCAAAGCATCATAGTTGGTAGCTCTGACAAGTACTTGTGCGTCTGTACAGCACAGCAAGAGTTTGTTAG
ATTGATGACCAACTGTCATTCATTTCAAACTGCGGATATATCTTACCGAGGTGTCTTCGTCAAAGAGCGACAGAAGCTTTTGCTGGAAGGGACTGCTCGA
CAGCAAAATCTCACGGCAGTGGATTTTGTGGGATTTCGAGTCCATCAGTCGCTGTAGAACCATCAGCATCCAGTAGACTGAGACAGACGCCCCACACGAC
AGTATCTGAGTAACCACGCCCATGTTTCCCAGGTACTCCGCTCGTTGCTGCACAATGCAACGGTGACAAGTTAGATTCACGACGGCACAACAGACGAATG
ATGGACGCAATCAAGCAAACTCACCTCCACAAGGATTCTCACAAACTCCTTCATAGCTGGGGGGGCCTGAATCAATCGATACAGAGCTTGCAGGTAGGTC
GGGATAAATTCATGGTCGGCTCCATGACGCGTAACGATCTCGTGAAGTTCTCGTGCAACAACAAGCGTTGCTTTCTCAAATGGTTTGGTGGGCTGCGCAA
TTACGCCAGGAGTGGGAGTGTTCACATTCAGCTCCAACGCCAACAAATGCAATTCTTCGTCAAGACCTTTCGGTAGCTGCCGCTGCGATCGAACAGTTTT
CCCGAAGCCATGACTGACAAGTGACGCCAAAATGCTTGACTGAACAACCCGAAGCTCGCGATCCGTGGTATTCACCTCTTTTCCAGTACTGACAAGGAGG
TTCCCCCCTTCAAGCTGAATAATCTTTCGCGGAAGCATGCGCATCCATTCCGGGTGGAAAGTTGTCACCACGTCGACCTGATGGTTTCCCAGTGCGTGGC
ACGACGCCAGCAACTCGCACACGATTTTCTCGCTGTGCACGCTATTGTAGGTGCGCCGAATTCCATCCACGTACAGCACTTGGAACGACTGCGGCGAGTC
GCGGAAGAGGATAATGCTGTAGATGCGAGACAGCGGACGACTTGAAACCACGGTTTCAGAATCCACCATCGACTCGGTGATATACTTCTCGGACACGGAC
AGCAATCGAGGCGTAGATTTCTTTGGCGACAGCGAAATCTTCTGTACTTGATACTGAAATGATGTCCCCTCAGCCAACGACGTCCCAGTTTCATCCTTGC
ACGCTGCCTCCATCGTCTTCTTTCGATATTCGTTCACTTGCATGCCATACGATCTTACCACACGCTGGATCGCCTGCGCCAGCTCCGTTCGCTTTGGAAC
GATGAAGAGGCTCGAGTTGTCTGAGTGGTTCAGACTAATTGCCGCGTGGTCGTCACAGATCAGATCGATGGAGACTAGACTCGTATACGGGATGTGAGAC
ATCAGCTCGCCATCGCTGTCTTTTTGGTAGATCCCGTCTGGTCTCACCTCAATGACACAAGGAGATTGCACACCTCGCTTATGGTACTTGAAGCTCTGGA
AAGCGTGCGTCTGTAACTCGGGACGAGTGATTTGGCCCGCCGATCTCGCTTCGTGCAAGCTGCGCAGCCGCATGAGGCACACCAGCACTTCCATTCGAAA
TTGGCATCGGTAGACCGTTTTCTTGACTCGATGCCGTGGCGTGTAGATGATGAAATCCTGCACAACGGGATTGAGAAAGAAGTCGACGTTAGCGCAGTTT
TCATCTTGATCGCGCAAGCGACAGCACAAAAGCATTGATGCACACAGGCTTTACGTACCGATTCGCCTTCGACAATGCTCGCAGTATCCACATCTTCGTA
TCGCCAGCTGTTCGTGGGCTGCCTGTTGTCCAGATCGTAGGTGTAGAAACCCGTCTCAGCAAAGCAGAGCACGCGCTCCTTCGTGACAAAGCTGCCCACT
TTGTGCACCATGAACCGCGCCACGATTCGCTTCATATCTGCCTTCGCCATGCTGCTCGCGCTTGTTTGTATCTTTCTGTT