Description :
From Genome Similarity Track
Location :
Scaffold_21:190615- 193376
Sequence
2761 bases(100 bases per row)
CAAGTACTAGCAGTCAGCAAATTCTTTGCCATCTACTTAGCAGACGACCATGTGTGAGAATCGAATTTTTCACAATATACGAACTTCTGCCTGCAAAAAA
AGCAGGAGGACGGCAGATAATGCATGCATTCAGCAAGTTAAATGTTGCAGCGGTAAAGCCTCAAACGCCGACACCAAGGAAGGACGTCATTATAGACGGT
ATGACAAACCTATCATCCTTTCTTGCATCGATCTGATCGACTTTATCAAACTTTTAAGCGAGAATGAGACGCTCCTATACAGAAGCAAGTACCACAAGTG
GTATTCTCTGGAAATGGATAGTGATGCCACGAGGGCCAAGTAATGTTTCTGACACATTCAACGTGTGACAAATCGGTAGAGATCGGTGCGAGACTTCGCA
CCTGGTTAGTTAGATGACATAGTCTTCCATAGCCAAGATATGATGGGACAGAAGGATGTAGAATCCTATCTTCCTTGCATCCGGAAGGTTCTAAAACTTA
TGCGCGAGAATACGCAGTACGCCAACCTTAAGACGTGTATATTTGCTGCGAGCGAAATACCACTTGTGGAGGTTATCGTTCGAAGAAACAGCGTATGTAC
TGATACAAAGAAAATAAAGGTGATCACCGACTAGTCATTGCCTGTCGATGTAAAGGAACCTTAGAATTTCCTTGGCTTAGCGGAATACTTTCACAAGTAC
TCACGCAACTACGCCGTCTATTTCGTTTTTATTGAAAAATAACGAGAAGTGGATATGGATTGCTGAGTGTCAGCGCTCCTCCGAAGTTATTCAGCAAATA
TTTATAAAGTCGCCAGTGCTGGTGGTTTCAGAACAGGATAGACCATTTCACGTGTTCTGTGATACCAGTGAGTATGAAATTAGCTGTGCAGCAATGCAGT
ATGGTATAGATGGCGCGGAGCGTGTCGTCTTTATCAGTCCTTTTATTATCAATCATCTGAAAGTAATTAATTCGTGCATGACAAGGAATTCTTTCTATGC
AGTACGCATTGGTGAAGTATAGGGTCTATGTGTTAGGGTATAGTCCCTTCATCATATATAAGGAGCATGAGTCATTACGTACGACCGTCTACAGTCTGCA
CTTCTGCCAAATAATGGTGATATCGATTACTTTCTTCGCGAGTAAAACCTCCTAATCAAATCCAATTCAGGACGAATCAATATCGTCGCTAGTTCGTCTT
GCTCCAACCCGATATCGTACCAGCTGTGCAACTAAACGGCGGGGCAACCACTGTTGCGGTATATTTACATTAATCACTCCGTCATCGACATGCGTAAACG
ACATACGAAAGGGCGTATGAATGTGATTCAGTAATTGTGAGCTTGATAGATCATGTTTCAAAAACTTCTCAAAACATTTCGAATTAGTCTTCGGCGGTGG
ATAGGTCTTCCACGGATAAATACACAGTGTGTAACGGCTTGTTGAAATGTTTAGCCGTTTCCGGTGACACATCTCGTTACGACCTGCCCTACCATGGTGA
CTTGGAGCAGTGGATTATGTTCGGGTATCACGACGCAACTCTTATTGGGCATCGTGGTCGTGCGAAAACATATCGCACGGCGATCCGGGACTTTAAGTGG
CACCGCCTTTATCAGTCCTTGCGAAATTATGGTCGTTCTTGAGAAGTTTGTCAACGGCTAAAATCTAGTCCTTTACTACATGCTAGATTACAGACTCTGC
CTGTTTTTTCAGACTTCTGGGAGTCCGTTTTAATGAAATTTGTCTTCGGATTCCCCGCTGACTCACACAAGAATACTATTATTCTTGTGTTCTCTGATAG
ATTCAGCAATATAGTACACCTTGTAACTCTGCCTGAATTAATTACAGCATCGCATTGTGCGTGTGTCGTCATTGTCATATTCTTTCGCCTTCACGGGTTG
CCACGTGAACCCATGTTCTATCGAGACCCGCGCTTCACAGATAAATTATAGCGCTCCTTGTTCAAAACAATCGGAACGCGCCCAATAATTTCTATTACTG
ATAATATTGAAACATATGGTCAGAAAGAACGCGCTAACCGTGTTTTCGAAGATATTCTTCGAGGATACATCCATTTTTTTACAAATAGGATCGAAGACTT
GTCAATGATAGAGCTTGTCATCAATATCTCATTACAGTGCTTGCGCCAATAACGCATAAACAGTTCTTCTTGAGTAGCTTGCGCCATTTGCAGTTACCCA
CTTTCCTAGAGTGTGACTCTAATTTGAGGAGGGGGGGCATCGAGAAAACTAATTCGGATCTCACATCACTCACTGACCGTGAGGTCACTACATGCAATGC
CGAAGTACACTACATCGACTCCGGGTAAGACTGGTTAAGACCGAGAATACTGAGCAATTTAGCATCATTCCAGCGTGTACGAAGATGCACTCGCTTAAGC
ATAAACTGATCTTGCTGCAGTGAACTCACAGTGCACTTCATATGAAGACAGCGAGCTAGCAGACGAATTCGTACTGGCTCACAAACAGTATTCGTACAAG
ATTATCGCGGAAGTGGTGTGTATAGTCAAAATCGACATGCTGACATATATGGGACCGTATATGGTCTTATATTTATGAGGGTGACTGTGTCCTGATACCT
ACGGTAAACCTAACGCGACACATAGTGACTAATGTGGGCAGTTTCATCAACCCATTTGTGTGCTGCGCTGCACAGACAAAGCATACAAGACTAAACTGCC
TCGCAGGATGCGCATTCATCCAAGTTTTACGTCGGTCGCCTCAGGCCGTACTTTCAGTACG