Description :
From Genome Similarity Track
Location :
Scaffold_424:1906- 5993
Sequence
4087 bases(100 bases per row)
TCTTCTTTGTGTACTTGCATCACTTCAAACCGATTCCGTCTAGCTCGATCGCATTCAATATATGCAACAATGCACCACAATTGAGGTTCGCTTCATCCAC
CCAGGTTTCATCATTATGACCCCTTCACCGAACCAGGAACTGTCGGTGTATTCTTCCATACCGAGTTTTTCGCCCCGACCTCACATCCATAATGCTTCCC
ACCTCGTATTCCTCTTCGGCTAAATTGCCTTTCCAACTATTATCCGGCAGTAGGGCTTCATCAAAATCCACTCGCTCGTTTTTTTCCACCTCCAGCCGTG
TAACAGGTCGGTCAGGAAAACTTCGTACCAATTGAACTTAGAGATGTGCACGAGCGGGAATAATCGGTATGGGGTTCCTTGCAATTCCAGCCACACTACA
TGTTCTCCACACTATTCGATCACCCGGAATGGGCCATGCCACATGTGATTCAGGTTCCTGGCATATCCTTCTTTCACTTGGTCCAAATATAGCCACACTT
GGCTACCACAGCTTATTCATGTGGCCCTTGATCATTGTTGTGTTGGTCATCCCGGTCCTGAATAGCTTCCTTCAGCCGGTCATTCACGGTGGCCCGAGCA
CGTTAGTATTGTCGCTGTATGTGATAGCGCCATCTCCTGGGGTCACGATCACGTGTTTTGGTGCATCCCAACGGAAGGGTTACTTCCAACGTCGACCGCG
GGTCCCATCCGTGGATGAGATAGAACGAAGTATCACCCCGGAATTGTTCATATTGATGGCGAAGGTCAATCGCTCGGCGTAGTCATCCCAGTCTTGTTGG
TTCACGTCCATGACATACATCTTGAGCGTCCTGGTCAACGTTTGGACCATCTGTTCGGCGGTGCCATTTTCCTGAGGCCGATACGCCATTGTAGCACGCT
GCTTTTGACCGGAAATACGGTTGAATGTGTGATAGAAATCCGACATGAATCCAGGTTCGCGATCATGACGAATATATTCGCTCTCTCCAAATAGCCGGAA
GACGCATTTTTCATATCCTTCCGCGATCGTTTGAGCCATCCTCGACGAGCTAGCCTTAGCGATCACGTAGCTGGAGACAAATTAACCCAAAAACGTAATT
CAGTGTCTCCTTTGAATGACTGGGGAAAAGAAGGGATATGATCAATTGCGATAATCTGGAACGGGCACGTAGCTTGCATGTTCCCCGGGGATTCTCCTCG
TAGCGCCTGAAATCCCTTTCCGGTTTCTCGGTCGAAGCACTTCTCCATATACTGCTGCACGCTTCTGAACAAACCTCTCCAATGGAAGTGTGATCTCACA
CGATGATACGTGTGGCCTACCCCTTGGTGACCACCTTCCAGACTTGCGTGGTAGTGGTGTAGAATATCATCTTAAAGCAACTCCGGGATTACTAAACGAA
AGAGCCCAGCACGGTCACCGGGGTTTGTCGCCGATCGTGGGAAAAAATACGACAATCCGTCTTCATTTACCACGTAGACTGAGGCAATCACAGCACTTGA
TTTTTCTTCTGTAGCACCCAGTTCCGTTGCATCTCCGACTAGGTAAAGTTTGAGGTTAGCAATCCAACTTTATTCGTCTTGCGCCTGTTTTATATGGTAG
AGTCACATCTGCTGTATTACGTCTTTTTGTATAATGGTGAGTGCCTCACGCCTTCGCATGGTCGATCGCTTCATCGCCTCCATCTTGATCACTTGATCAT
TGCCCGCTGGCATCAATATTTCGTCTAGACGGTTGATAGATTTCGGATCATGGTGGTCCTGATCCGTTAGCATAACCATGCCCTTTTCTAGATGTAAGAC
AGTGCTAGCCAGTCGATCCGCACTTTAATTCCAATCGCGCTTGACGTGTAAGAATTCATGTGTCGGCCACGAAATAAGTTGATCTAGGGCTCTGAGACGC
AATAATTGTAGTCCTGGTGCTTTGCTATCAATTTCACCCCGCATCTGCCTGATGACCAGGTTGGAATCCCCACAAATGACCACTCGTCCCTTGTCTGTTT
CACTAGCAGCTCGCAGCTCAGCAGTAACCCGTGATACTCTGCCTCGTTCACTTTTAATCCAGTGTCGAAGCGCGACGCAGCCGATAATATGGCCCACTCG
GGTAATTTCCGTATCACTGCACTGAAGGCTCCTCCCTTTTTTCTTGATACGTGCTGATCCGTTAACGCTGACGACCAGAAGCACTTCGCCACGTCTGACC
GTAGGGAGAGGCATACTGATAGTCGGTATCGGTTGCTTCCGTGGTGTGATCGCGATCAACATGTCATCCATATCTTCCCGCGGTGTGATACTCACTGCGA
GGGTGCCGAAGATTTCGTCCTCCTCTTTGTTACATCGACTAATCTCCAAAGTCCAAGTCGACAGTAAAGCTGCCCATCTGCCAATTCGTCCATTGAAACC
TGACGACTGCATCAACCATGCTAAGGTAGAATATCTCGTGAGAACCTTGACATCCCGAGAGACCAATAGCGTATAAAAATATCCAACATCCGGAGCAGGG
CCAGAACTTCCTTCTCTACCGCTCCATAATTACATTAATTTGGTTTTAACGTTCTACTTGTGAACATAACGGACCAATTCACTCCATCATGTTCCTGTAG
CAAAGCTGCGGATACCGCCCATTTGCTATCGTAAACCACGATCACTGGTCGGCGGTCTGGATCAAAATGTTTGAGTACCGAGGTTTGGGCTACTTTAGCC
TTCAACATGGTGAACGCAATCATGGCCTTCCCCCAACGATGAGCACCAGTATGTTCTTTATAGGACTCTTTCACTTTAACTGGAGCCTGATTATTCGTTG
TCACCAGTGGATGATCGTGATCACTTGCTGGTCGCTGCCCACTGTCATCATCAATCTGGGTATTATAGCCATGATCATTGCTGGGTGAGCCTTCAACTTC
CGTGCTGTGAGAACGCCTGATCTCATGTAAAACAGCTTCCATCAATTTGTACAAAACCGAGGCGTATATGGCGAAGTCTTCAATGAACTGGCTGTAATAA
TTCAGGCTTCCGAGGAAGGACTGTATTGAACGCAGTGCCTGAGGAAAAATAATACTCACCAACGACCCCAAATCCGTCGGGTCAGCTTCGATTCGTTTTA
TTGACACTTCGTGCCCGAGGTACTCAACCTTGTTTCGTCCCCAGACGCTCTTAGGTAGGCTGATCGACAACTTCCAATGATCACACACTACCAACAATCT
TTCCACCTTCCGATAGAGAGACGTCCAGGATGACGCTGGGATTAGAATGTCATCAATGTAGGACCTTCGTCCTAGAATCGAAGGGTTCCTGTGAGGGTTT
GGTTCGCCGTCCTAAACACATCGACCTGTTGAGACGCCTCGTGGTCATTTGACTTTGGCCGATCTCCGATCATAAAATATCCATATAACGAGTTATCCAC
AGTACGTTGATATATTTGCGGCACGTTCTTCAGAACGAACTCCATGCGTAACCATTCATACAGACCAGAGGCGTGAATAAAGCAGAGATCATTCGTGCTA
TTTCCGTCATCTCCACAGCCCAGAATCCGCTGGCCATATCCAATGAACAGTACCATAGCGCTTTGTCGAGATCCTGCAGCAAGTCGTTGATCAGGGGCAT
ACGATATATTATCAGTATCATCAATTGGTTAACTCTTCGGTAGTCTATACACAGTCGCATATCCACCCCATTATTTTACACGATCACTACGATCGGCGAC
GCCCATGGCGAAGTTCAGAGACACATGATTCTTGCTGATAGTAACCCTTTAATCAGGTCCGCCAACTTTTCACAGAACTTTGGGGCGACTGGCCTTACTC
GTTGTGCGATTGGGATTGCTCCTCCAACATCTACATCGCAGATTACACCTCGAGCAGCATGTGAGAAATCATTGTCTTTGCCCATCAAAGGGTATAGTTT
TTTCCAGATCAGCTGACGTAATTCTTCTTGCTCTTTGGTCAATTGGACCCCTGGGTCGCCCACCTGTATGTCGTCAATTTTTACCTCGCTCAGCATCACG
TCTACATCTGGTAAGACTGCCATGTGTTGGCCAACGTCTTCCTCGAACAACACTCCACTTTCGTGCTGGTATGACGAGCATTCGCGT