Description :
From Genome Similarity Track
Location :
contig_27:190594- 192547
Transcript NameFunction/comments
g5920.t1conserved hypothetical protein

Sequence
1953 bases(100 bases per row)
GTCACAAGATCGCCGAGCTCGTTGAAAATCAAGAGCTGACCCTGAACTACATTCTTACAGCAGACAACATAGGTGATATGTTTACCAAGGCGCTCGGACC
ACTGCGATTTGCAATGCTGCGAGAGCTGCTTGGAGTCGAGGACGTAGTTGAAGCTACTGCGAATTCGGGCCTGTCAACGCGACGAATACGTGTTGAAGAC
CAGGATGCATGAGTTCCGGGGGAGTTTGAGAGTCTAGGACTGACAGAGTCACTCGTTCTCTCTCGTAGTCACTCATGTCCTGGCCGTGTTCTATGACAGA
TAGGAGTCGGCCTGCAACCCCTTTGGTTGGGTTGCAGGTCAAAGGGGTTTTTAGGCTGATGCTTTCCTCCTCGTGCACGGCACGTATAGAAGGCATGCAT
TGCAGGCATGAGCATTGAATTAATCACTTTGAATTTACTCTCTTGCAAGCAAGTGTCTCGTCTTCGGTTGTCCTCCTACTTCGCCACACACTCGCAGTGC
TAAGCTGCTAGGTTATGTGCTGGTCGGTACATGTATTAATACTGCTATGAGTAGCATCTGTTCTTCCGATCGACGTGTTTTGTCAAAGAAGCAGGATCAA
CCGGAGGTTCTTCTTCTGTTCATCGATGGGAATGACGGCTCTTTGCTCTTGACAGTCCCGATGATGTCGCGGATGCCTTTGTCGGCGGTGCTGTGCTGCA
CTGCTGTCGGACTCTGCAGCGCAGAACCAAAACGCAAGATGGTTGTGACTACAGAGCGTTAGCCCCAAGGAGAGGTCGCAGCCGACACAGCACGAAATGT
AGGAATTGATATTTCGCCTTGGAGATGAAGTTGTATGTATCTTGGTTGTAAGTATGGTTCGCGCGCTTGAAGTAACCCTGTCTTCAGAAAAAGCAGCTAA
ACTGATGACCGTCTGCCTGGTGTTGTGATGGTCTTCTATAATTGCTGCCAAGATCGCTACATGTAGGACCACGATGGGTATACGAATGTGAGCCGGCCTT
CTGAGGGAACAACTTCAAGAGAACAGTGGGCACACTACATAAATACAACGAAACAGTTAGTGATCTACTCTATGCTAACTCATAGTAATGCTACATACAC
CACGTACCACTTCGAGACTTCGGCGTAATCGACTCGCATGTACATTAGACTACGAACGCTGAATATCAGCTTTTCCACGTGGAATACATCCCTCCAAACG
GAGTGCTCTACCATTGTCACAAGGGTATCGGAACACTGGTTCAATCTTGTCAGGCGAGCGACTGGTACGAGCGACCGGTTAGGAGTTAGCATCACCGTAG
TGAAAAGCCACTGAATCCTGTCGACAAGCTCCTCGAAGGCACTCCGTTTTTCAACAGGACCATGCGTATTTCGCACGTGTTCTTCGTAACTGGTCACGTA
GCTAAAATCCTTTTCCACGCGATCGATGTCTTCAAAATCTTCTTCACCGACAGCAGATAACGACATTCGTGCGGATAGCTTTGACTTCAGATCAGCTGTC
CAGATAAAAGTAGATGCCGACATCTTGCTGTATGCTCCGCAAACAGACTTATAACGGTCATTCCACTCACACACCCGTGGAATGAAGTTATGGTTTCAAT
CTGAGTGACAAGTTTCCCAAGTTGTTTGTGAGAATGGGGATTCCAGCCCTCATACTGACCCTCCAGGAGTTCGGTTATGAAGAACATTATGGAGTCAAAC
TCGATCACAGAAAAGCTGTGATAGAACTCCCACCCGCCGTATTCCCCTAAGATCTGACCCACTTTAGTTTTCCTGTTGCTGGTCATACTTTGCATTCCTT
CAAAAGGTGTTTGCAAATCTGCAGACAGACCTACAGTACCAATGCATGCGTTAGTAAACAATATAGTAGGAAACGTGAAAGACGCCACGCCATACTAGTG
AAGGGTCCTCGTCTTGTCCGGATAAGCATCATGCAGCTGCTTCAGGGTTTCTA