Description :
From Genome Similarity Track
Location :
scaffold_19:190579- 192659
Transcript NameFunction/comments
Plaha_PHALS_09620hypothetical protein
Plaha_PHALS_09621agc protein kinase

Sequence
2080 bases(100 bases per row)
GGTACTCCAACGCTTTGCCACTAATAAGATTTTCGGGCTTGTTCACGGTAAAGAAAGGCAACTCCTGTTCGCATTTGCTTTTAGAGGCCTCCCGCTTCCT
TCTCCACGCGTTAACTTCAGCTTGTAGATCCATTTCTCGCTGTTCTAAATGGTCAATTTGTTTTAACAGCGCAATCCGACGGTTTCGGTACTCAGCGCGT
TCCTCTGCAAACCCTCTTCTTAAAGCATGCATTTCTTTCATGTGTTTTGCTTCCCACTTAGCCCATTTTTGGACAATTTTCGCAGCAATTTCAACGCCAT
TCTTTTCATTAGAAAGAGCTTTTGCAAACTCTTTTACGACACTCTGCTGCTCGCTCGCTCCGTGTTGATGACTTTGCTGAAATGTGTGCTGCCGTAATTG
TGCGAGAGCGCCTCGAAGAGCAAAAAAACATTGAATTGTGGGACGATGGTCCCCTTGATCCTGACTAGCACTTATTGGACAAAGTGGCGAGATCTTTACC
AGTTTTGTATCGCTATCAGGTAAAATGTGTTGCTTCATACACTGCACAATAGCATCACGCCATGCGTACAGACATGCTTGAAGATGCTCTAGTCGTACAC
CTTGAACCTCCAGACGGTGTTCCAAATTCACACACGTCGACTTTTCTGATTCAATCTCCGATTGACCCACAAAGAGAGTGAGCGGACTCTGCACGCAATC
ATACGACACCTTCATTGCATCCATTCCGAactgtaatttttttaaacaaTCTTTGAAGATCATATTATCTTCCATCTTGTCGTCCTTTTCGGTAGCTCTC
TGATGCAGCTCGTTCTCCAGAGCAACATTCCTGTCCTCCACCAACTTCAAGTCTTTTCCAAGCTTCTCCAGGAGCTGGCATATCCTCAATTCCTCTTCAT
TCTTGCCGGTCTGCGTACAACTATCTTTTACCTTTCTCTGAACACTCTCAGTCTGTATTGCTGCATCTCCTCTCCGCATTTCGATCCTAATCTGCACTTC
TTTGTCCTCCTTCGTCTCTCTTCGTTCTAATTCATCTAGCACAACGTCTAGCTGCTCGCGTTGCTCATTCACAATCTTTTGCAGGCTCAAAATTTTTGCA
TCTTTGAGTCTCAGCGTTGAGAGAACCTGCGCGTTCTGTCGCTCCTGTTCAGCACGCGTATCTTGCTCTAATTGACACAATGATCGGGCAAATTGTGGGT
AGTGCTGAGCCAATTCATGCTTAATAAATGACTCATAGAACTGCAGGAAATTTGTCCATCCATTCGCATTGGCTGCATCTTTTAATTTCATGTGCGCGTT
CAAGACGGCCCTCTAAACGGTACAACTTCAACAATCGCATAGTACAATCACCATAGTTGATTTGTGCCATAATTATATGATAATATAATTCATGTAGTGC
CAATATCATGAAGTGCCAATACTACTATTGTCATGTAGTAGTGTGACAGAAAATTATATGACTCATTTTTTGTGTACTTAATTTCAGAATTACGGGGTTA
TGTCCTTAAAGCAGCATCTTACGCGTACTTTCCAGTCTCGAGTCCACGTCCGTGCCATCACTATTCGTAGGCGACACGGATTGCGATAATGATCTCAACG
GCTTTTCTTTGTCGTCCGTTTCTGCATCATCCTCATCAGATGTCGTTTCCACAAGGTCGTTCAATCGCTCAGCAGGCTCCGCAGCCTCGTCTTCAGTGCC
ATCCAAGCTTATGAAAGAGCAGGCCGAAACACCAAAGTCCGTCGCTTGATCCGGGCGTAACAGCGTTAAGTCAAAGTCCAGACCGTTCGTCGACAAGAAC
GTGGCCAGCATTCTGTCTTTTGGTTGTCCTAACGAGTGAGACTTCAACATTCGATCGCTCGTGCTGTCGTTTGATGAGATAGGCGACAGCGGGTTCTGAC
CgtctccttcttcgtctgGCTCAGGCACATCCCGTTGCTCTTCTTCTGGGCCATCCATGTAGTTAAATGCAAAATCGTTGAACAATTCGTCGTTTGAGCT
CTTAGCTGACGCAGGCGTGTCAACAGGGACTTCGATTGTGTTCATGTATGTCTCAAAGATATCGTCCGTGCGGTATTCTT