Description :
From Genome Similarity Track
Location :
contig_48:190550- 194947
Transcript NameFunction/comments
g10282.t1hypothetical protein
g10283.t1POM81161.1 Hypothetical protein PHPALM_906 [Phytophthora palmivora var. palmivora

Sequence
4397 bases(100 bases per row)
TCTCAAACAGCTTCACCAGCAACGCTGAAGGCGACTGCGAAGTTCGCGGCAACAATCTGCGGGCCGGTGCTTCTGCCGACAGACCTGGAGCCGCCACCTA
CAGAGTCCATGGTGGCCCAATGCAACGGGACACTCTACAAGCAGTGCCACCAACCAGGCGTTGACGAAGCCATGTGCTACAGCTTACGATTCACAGTGCT
GAGTTGTGTTCACAGCCCGTTCATCATCCAAATGAGACGGCGACAGATTCAAGAACGGGTGGGGGATACGTGTAACCCAGAGTTCGAGGCGTGGCTGGGC
TGCAAGTGACTGCGAGACCCACCTACAAGACAAGAATGGAAAAACGCACTTTTCATTCCTGCACAACTACACGTAGCTGTTTCATGACCCTCTTCTCAAC
CCTCTGCAGATTAGTCTTCACCCCCCATGTCCGCTTCTTCTTTGCTGCCTTCGCCACCACCTGACGCCGGCAAGTCCAAAGGCTCCGTCGGGTTTGCAGC
CGGAGCTTCCCCTACCGGAGCTTCATCTTTTGAGTCCGAAGCCCCAGCCGAGCTTTCATCTTCCGAGTGACTTTCAGCTGGGGGTTCATCGTCCCAACCG
ACTTCAACGTCCGTGGACGAGTCCCCCACCGTGACGTTGACAAAGCTTCCGCTTCCGCTCCCACTGCCGTCGGATGCACTCTTTCTCTCTCGGTTCTTGT
AGCAGTTGATGTTGCCCTTGCACTTGTCCTTGTCCTTGCTGAACATGCACCACGTCGACGACTTGAGCGAGCACCAGCCGTAGCCGATCGAGTTCCAGCC
GAACTGCGCCTCCATAGCCATCGCGTCGTCGTCTCCGGTAGTGACATCCAGCGTCATAGTGTCCACTGCGCCACCGTTCAACGCGAACACATCCACGGCG
GCAATGCACCCGACGAGCAACGCGGCAGCCCCCACGACCCCGAGCAAAGTGCGGATGGCACGACGTCTCTGTCTCATGCTTGTTGCATCATGTTGCGCTG
CCTGCTGGTACGCAGACAGCAGCATGGCCGCTTCCTCCCCACGGTCAGCCCTCATCACGAATCCCCGATCGAGAACGCCTCCTGCCTTCGGTTCAAGTCG
AACTATGACCGAGATATCGGAGACGAAGGATCTTTCACCACGAAGATCCACGCACCATGAGCGGCTCACAAGCGTCGAGGGTCAACGCCGAGGGACGCGA
AACCTTCCTTGAAGATATCTCCCTTCCCGACCGCACATTTCGACACTTGTGGCCTTTCATGGGAAATGTCGGCGACTAGTTGCACTCGATGACCTAAATG
AGGTTGGCAGAGCGGGCTCGGCATCCGTTCCCTACGGTTGAGAGCAACGAAAGTGTTGAGGTTCTTGGGGGCTATAGCTTGGTAATAGAGAAACTACCGC
CATCCGAGCACCTTCACAACCTGCACCAAGCTCCCTACTGGAATGTAGCGATTTGTCCATAATACACATTGTAGCTATCGCATCGTCGCCAGCTGAGCGA
CGTTCTCTGTAGCTCTCTTTGGTCGCACCCATTCCTCGTACGTCTTGAGCGCAATTCCCCAGATGGGGCACGAACTAGTGCCAAGGCGCCTTTTCTGCGA
TGTTTGGGCACTCTCGTCTACTAAGGTGACCATCAAGATAGAGAAACCCACGATGGAAACTACTACCAAGTAGTTTCGCTTGGGGTATATCCTACGCTTC
CTCGCTACTTTGTGGGGGCTCCAACTCATTTTACTGGTGAAAGCAGAGCGTAAAGTTGACGTGTCGTTGTATGTGGTTGATCTTGCTTCAAGTTGCTCCG
AACGGCACAATTGATGTAGTGATGCAGACGCGGGAGTTCAGTGATGGATTTTCTGGTTGCTTTTACGCGTTTGATATTTTCGACCATTGACATTCTTGTA
TTGTGCCTCACAGTTCTCGGGAATTTTTTTGTGGTCCACCACTCTCCCAAGAAAAACTGGATATGACTGCTTTGGGTAATGCTCCGGGGCAAGCGTGACA
TCAATCTCCTGGGTAAAGTTTAGTCAAAGGGAAAGGAAGAATCGACGAGTAGCTGCTCATTTGTCCTCTGACTCAGGGTGACCAAAATTGGCATGCAAGT
AGAGACGGAAACCACATCGCTGACCACGGCCAGTGAACGAGGCTATACAAGCAGCCAGCGTGGTCTTCCGTCTGTGCACTTCGATAACTGCACAATATTG
CTTCGGGCCTGCGTACAAACCGCATGTAGTAGGATGTATCTACATGGTAGCCTCGTCGTCTGGAATGTTGGCCTCACCAATGCGGGCCGGATCCGTACCG
CGAAGCTCGTCAAGGTTTGCTCGTGGTACCTGACAGAGAGTAGAGGTGCGTGACCCCATCGTCCGAAGGGATTTGAAGACTCGTCGAGCATCTCGAATAT
CTGCATTTGGAGAACATGAGTCATGATCAAGTAGGTTGGTGGACATGTTACATGGCCACCAATCCCTTTCTCTATACAATTTGTGGAAGCAACCTCCAAC
GTACATCGTATGATATCTTATAGCTAAGTGCTCTCCGCCAGCCTCGGTGATTCACCCCCATTGCGTGCCTGGCTACTAACGGGTGATTCACAGCACCAGC
AATTTGGGGGAGGTGAAGGCAGTTTCAACAACCGTCGGCGGGAATGAAAGCAGCAAGAGGGAGCGCTAAGTTACATGTACACAGGAACAACTGTACTACC
TGCTACCAACACAAGTCACGTTGCGATCGATCACTGAAGTAGTACACGAGCTGCACTGACAACGGTAGAAACGGGGGTAAAGTCAGTTACTGTACTACTG
AATTCAACTTTGTCGATCACAGTGGACCATTGTGGCACGATACGATGCGCCGTATGAGCTTGCAGACCAACTAAGGCTGCTGCACCGAAAGAAAAAGAGC
TAATCTCATCCAACGAAAAGCCTGACACAAAGGGAAGTTGGACAGTAGTCAGAAGAAAAAGGAAAGTCGTCAGATAGTAAAGCTCTGAACGAACGCCAAG
CTTCCTGGCGTCCAGAAACCATAATGGTTAGCTTGTTGATGCGCCGAAGCCACGTCTAAGAGTTAAACAAATGGAGCGCTAAATGGCACGCGTTCTATCA
GGTATGTAGGACACCCTTGACATTCGGGAACGAGTCTTTTCACTTCCCAATCTGCGGCGGTCCCTCGACGCGGTCTCTCAAGGTCTGACAAATGGCAGCT
CTCGCTCATTCCACCCTGCCGTCCTTGTCTCCGGTGCCCAGACCCTACAGCATGCAGAAGATGGAGCGCCGACCTCCGATTCATCACGCGTCTCGCGACT
CGTTCGGACGTGCCAGTATTGGGGACAACCAGGATGTGTACATCGGAGAAGGGCTCATCGACCCCAATGGCATGGATGATCTAGACGAAGACGCCCCTCA
CAAGTCTCACCACCACGATCGGAAACATCTCGACTATTTGGCGATCGACATCGGGGAGAAGTACCTCGACGACATGTACAAGGAGGACGACACCGACGAC
GACAATACCGACGGCGAGGAAGGAGGATTCCTCAGCGACGGACCTCCGACGTCAAGTTCCTATCACTCGATGCAGCGGGCAGCAGTAGTCAAACCGGCCG
AGGTCGACTCGGTTCTGTTGGAGCAGATTGAAGAGGAGGAGCAGGCGGAACGCCACCGAGTGGAGAAAGACGTGGCGTGGCAGAAGGTGAGGCAGCTCCT
GATTGAGGAAGAAGAGAAGGCGGCAGGTCGCAAGAAAACACGGACGTCTTCTGGAAACGGCGAAGACTACGGGACCGTCAAACTGCTCGACTCGTTGACG
AGGACGGGGAGTGATGGGGCTCACTGCCACAGCAGTGGATACTCGGACGCCACGCCACGCGCGAACAACACGCGGCTGGTTCCCCACCCGAGAGATCCGC
CACAGACGTTTGCGCGCCACATCGGCAGCCGACTCGCGCATTTTCTGCATGGGGGACCAGCCTCGGTCCACGGAAGTGCCGGCTCTCACTCGTGGCGCTC
TCAGTCCTCTTCTTCCAGTAGCGACCTGAGCCAATCCACGCTGCTGGCGACGCTGGACGAGGTGACCAAAGTTTGCCAACGATCGGAGCTGTCGGAGCTG
TCGATCGCGCAGATCGCGTCGCACTTGACTTCGATCGACCAGATCGTCCGCGAGGACATCGCCAATCACCACAAGAGAGGGTCGCGTCGACTGTCGAGCA
CGCAGAACACTTACGACTCGAATGGGTACGACATCGAGTACCGAGTCCCGACGTACCCTCGGATCGTCGGGCGAACGTGGCGCCAACTGTACGCAACTCG
TTCAAGGCGTTCACTGCAGCCCAAGATTTGTGTGATACGCTGGCCGCTTTCAACAACCTCGTGAGAGATTGCGGCCTCAACGGCGTCAAGGTGGACG